Methods in Anopheles Research - MR4

Chapter 8 : Field Techniques8.4 Species Complex Authentication by PCR8.4.2 An. gambiae Ribosomal DNA Type – Fanello et al.Page 1 of 28.4.2 An. gambiae Ribosomal DNA Type (Fanello et al.)MR4 StaffIntroductionThe Fanello et al. (2002) method for differentiating between the rDNA types of An. gambiae uses arestriction enzyme, Hha I, to digest the PCR product from the Scott et al. assay (1993) discussed inAnopheles gambiae complex authentication section. The HhaI enzyme will specifically digest theSavanna form leaving 2 discernable bands while the Mopti form will only have 1 discernable band. Asmall 23 bp band is also created, but it is not seen on standard agarose gels. An alternate PCR basedmethod is presented in Chapter 8.4.3.PCR discrimination of Mopti & Savanna members of the Anopheles gambiae complex (Fanello etal. 2002)Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. 1 Add reagents in the order presented.96 48 1 Reagent1235 μl 617.5 μl 12.35 μl sterile H 2 O500 μl 250 μl 5.0 μl GoTaq 5X PCR Buffer250 μl 125 μl 2.5 μl dNTP (2.5 mM mix)100 μl 50 μl 1.0 μl UN (F, 25 pmol/μl) [GTGTGCCCCTTCCTCGATGT]100 μl 50 μl 1.0 μl GA (R, 25 pmol/μl) [CTGGTTTGGTCGGCACGTTT]100 μl 50 μl 1.0 μl AR (R, 25 pmol/μl) [AAGTGTCCTTCTCCATCCTA] 2100 μl 50 μl 1.0 μl MgCl 2 (25 mM)15 μl 7.5 μl 0.15 μl Taq DNA polymerase (5 U/μl)2.4 ml 1.2 ml 24 μl Total (To each 24 ul reaction add 1 μl template DNA)Table 8.4.2.1. F and R indicate forward and reverse orientation. Use 1 μl DNA template.PCR cycle conditions94°C/5min x 1 cycle(94°C/30sec -o- 50°C/30sec -o- 72°C/30sec) x 30 cycles72°C/5min x 1 cycle4°C holdRestriction enzyme digestAdd 0.5 μl HhaI restriction enzyme to 10 μl PCR product from above reaction. Allow to incubate at 37°Cfor 3-24 hr. For shorter times, incomplete digests could be a problem.Run samples on a 2% agarose EtBr gel. Primers create fragments of 397 bp for Mopti and 225 and110bp for Savanna forms (Figure 8.4.2.1).1 Amounts for larger master mixes have been adjusted upwards to be sufficient for 50 and 100 rxnscompensate for imprecise measurements.2 Arabiensis primer not necessary if certain of working with gambiae strain.