Methods in Anopheles Research - MR4

More documents

Recommendations

Info

Chapter 5 : Insecticide Resistance Monitoring5.3 Insecticide Resistance Allele Assay by PCR5.3.2 Kdr – Knockdown Resistance in Anopheles gambiae – Hyunh et al.Page 1 of 45.3.2 Kdr – Knockdown Resistance in Anopheles gambiae - Huynh et al.MR4 StaffIntroductionResistance to pyrethroids in An. gambiae is commonly associated with a single base-pair mutation in thevoltage-gated sodium channel referred to as knockdown resistance (KDR). In Africa there are two formsof this mutation, the west African form which results from a leucine to phenylalanine substitution(TTA/TTT) (Martinez-Torres et al. 1998) and the east African form which results from a leucine to serinesubstitution (TTA/TCA) (Ranson et al. 2000). The method of Huynh et al. uses the intentional mismatchprimer method described by Wilkins et al. (2006), and results using this assay were reported (Huynh et al.2007). An RT-PCR based assay can be found in Chapter 8.5.1.3.Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. 1 Add reagents in the order presented.96 rxn 48 rxn 1 rxn Reagent680 μl 340 μl 6.8 μl sterile H 2 O500 μl 250 μl 5.0 μl GoTaq 5X PCR Buffer (containing 15 mM MgCl 2 )250 μl 125 μl 2.5 μl dNTP (2-2.5 mM mix)200 μl 25 μl 0.5 μl MgCl 2 (25mM)200 μl 100 μl 2.0 μl IPCF: (F, 2.5 pmol/μl) [CTAACGCGAATTAAATGCTTTGTGACAG]200 μl 100 μl 2.0 μl IPCR: (R, 2.5 pmol/μl) [CAAAAGCAAGGCTAAGAAAAGGTTAAGC]200 μl 100 μl 2.0 μl WT: (5.0 pmol/μl) [GGTCCATGTTAATTTGCATTACTTACGAaTA]200 μl 100 μl 2.0 μl East: (2.5 pmol/μl) [CTTGGCCACTGTAGTGATAGGAAAaTC]20 μl 10 μl 0.2 μl Go-Taq DNA polymerase (5 U/μl)2.3 ml 1.15 ml 23 μl Total (To each 23 ul reaction add 2 μl template DNA)Table 5.3.2.1. East African knock-down resistance. Lower case nucleotides indicate the intentionalmismatch in the primer sequences. Nucleotides in bold are located at site of SNP (where applicable). Fand R indicate forward and reverse orientation. Add 2 μl DNA template per reaction.96 rxn 48 rxn 1 rxn Reagent880 μl 440 μl 8.8 μl sterile H 2 O500 μl 250 μl 5.0 μl GoTaq 5X PCR Buffer (containing 15 mM MgCl 2 )250 μl 125 μl 2.5 μl dNTP (2-2.5 mM mix)100 μl 25 μl 0.5 μl MgCl 2 (25mM)100 μl 50 μl 1.0 μl IPCF: (F, 2.5 pmol/μl) [CTAACGCGAATTAAATGCTTTGTGACAG]100 μl 50 μl 1.0 μl IPCR: (R, 2.5 pmol/μl) [CAAAAGCAAGGCTAAGAAAAGGTTAAGC]100 μl 50 μl 1.0 μl WT: (25.0 pmol/μl) [GGTCCATGTTAATTTGCATTACTTACGAaTA]100 μl 50 μl 1.0 μl West: (8.8 pmol/μl) [CTTGGCCACTGTAGTGATAGGAAATgTT]20 μl 10 μl 0.2 μl Go-Taq DNA polymerase (5 U/μl)2.3 ml 1.15 ml 23 μl Total (To each 23 ul reaction add 2 μl template DNA)Table 5.3.2.2. West African knock-down resistance. Add 2 μl DNA template per reaction.1 Amounts for larger master mixes have been adjusted upwards to be sufficient for 50 and 100 rxns tocompensate for imprecise measurements.
Chapter 5 : Insecticide Resistance Monitoring5.3 Insecticide Resistance Allele Assay by PCR5.3.2 Kdr – Knockdown Resistance in Anopheles gambiae – Hyunh et al.Page 2 of 4PCR cycle conditions (East African kdr)95°C/5min x 1 cycle(95°C/30sec , 57°C/30sec , 72°C/30sec) x 35 cycles72°C/5min x 1 cycle4°C holdPCR cycle conditions (West African kdr)95°C/5min x 1 cycle(95°C/30sec , 59°C/30sec , 72°C/30sec) x 35 cycles72°C/5min x 1 cycle4°C holdRun samples on a 2% agarose EtBr gel; load 5 μlsample.All successful reactions should contain a band of 285bp. (Figure 5.3.2.1). In addition, a band of 210 bpindicates the susceptible (wild type) allele and one of188 bp the resistant allele.Figure 5.3.2.1. Gel electrophoresis ofknockdown resistance assay, east and westsamples from separate PCRs. The first lanecontains a 1kb ladder marker, Lane 2, westAfrican homozygous resistant (VK), Lane 3,west African homozygous susceptible (MOPTI),Lane 4, west African heterozygous (VK XMOPTI), Lane 5, east African homozygousresistant (RSP-ST), Lane 6, east Africanhomozygous susceptible (KISUMU1), Lane 7,east African heterozygous (RSP-ST xKISUMU1), Lane 8, 1kb ladder marker.96 well sample preparation template
Page 1:
\Methods inAnopheles ResearchSecond
Page 8 and 9:
Preface to Second EditionWhen Mark
Page 10 and 11:
Chapter 1 : Insectary Operation1.1
Page 12 and 13:
Page 14 and 15:
Page 16 and 17:
Page 19 and 20:
Page 21 and 22:
Page 23 and 24:
Page 25 and 26:
Page 27 and 28:
Page 29 and 30:
Page 31 and 32:
Page 33 and 34:
Page 35 and 36:
Chapter 2 : Anopheles Laboratory Bi
Page 37 and 38:
Page 39 and 40:
Page 41 and 42:
Page 43 and 44:
Page 45 and 46:
Page 47 and 48:
Page 49 and 50:
Page 51 and 52:
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64:
Page 65 and 66:
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
Page 77 and 78:
Page 79 and 80:
Page 81 and 82:
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Chapter 2 : Anopheles Biology Labor
Page 95 and 96:
Page 97 and 98:
Page 99 and 100:
Page 101 and 102:
Page 103 and 104:
Page 105 and 106:
Page 107 and 108:
Chapter 3 : Specific Anopheles Tech
Page 109 and 110:
Page 111 and 112:
Page 113 and 114:
Page 115 and 116:
5. Place eggs in a new Petri dish c
Page 117 and 118:
Page 119 and 120:
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
Page 141 and 142:
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
Page 149 and 150:
Page 151 and 152:
Page 153 and 154:
Page 155 and 156:
Page 157 and 158:
Page 159 and 160:
Chapter 4 : Stock Authentication4.1
Page 161 and 162:
Chapter 4 : Stock Authentication4.1
Page 163 and 164: Chapter 4 : Stock Authentication4.1
Page 169 and 170: Figure 4.2.3.1 Lane 1 1kb ladder, l
Page 171 and 172: Chapter 5 : Insecticide Resistance
Page 177 and 178: INTRODUCTIONChapter 5 : Insecticide
Page 179 and 180: Chapter 5 : Insecticide Resistance5
Page 213: Chapter 5 : Insecticide Resistance
Page 225 and 226: Chapter 6 : Dissection Techniques6.
Page 227 and 228: Figure 6.2.1. Larval mosquito midgu
Page 253 and 254: Chapter 7 : Taxonomy and Systematic
Page 265 and 266:
Collection NumberCountryNumber Le P
Page 267 and 268:
MOSQUITO BITING COLLECTION RECORDCo
Page 269 and 270:
Chapter 7 : Taxonomy and Systematic
Page 271 and 272:
Page 273 and 274:
Page 275 and 276:
Page 277 and 278:
Page 279 and 280:
Chapter 8 : Field Techniques8.1 Mol
Page 281 and 282:
Page 283 and 284:
Chapter 8 : Field Techniques8.2 Pla
Page 285 and 286:
Page 287 and 288:
Page 289 and 290:
Page 291 and 292:
Page 293 and 294:
Page 295 and 296:
Page 297 and 298:
Page 299 and 300:
Chapter 8 : Field Techniques8.4 Spe
Page 301 and 302:
Page 303 and 304:
Page 305 and 306:
Page 307 and 308:
Page 309 and 310:
Page 311 and 312:
Page 313 and 314:
Page 315 and 316:
Chapter 8 : Field Techniques8.5 Rea
Page 317 and 318:
Page 319 and 320:
Page 321 and 322:
Page 323 and 324:
Page 325 and 326:
20Chapter 8 : Field Techniques8.5 R
Page 327 and 328:
Page 329 and 330:
Page 331 and 332:
8070Mutant (S1014)Chapter 8 : Field
Page 333 and 334:
Page 335 and 336:
AChapter 8 : Field Techniques8.5 Re
Page 337 and 338:
Page 339 and 340:
Page 341 and 342:
Chapter 9 : Obtaining Live Material
Page 343:
Chapter 9 : Obtaining Live Material
show all

Methods in Anopheles Research - MR4

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?