Methods in Anopheles Research - MR4

Chapter 5 : Insecticide Resistance Monitoring5.3 Insecticide Resistance Allele Assay by PCR5.3.1 Knockdown Resistance – Anopheles gambiaePage 1 of 25.3 Insecticide Resistance Allele Assay by PCR5.3.1 Knockdown Resistance - Anopheles gambiaeIntroductionKnockdown Resistance, or KDR, is a commonly occurring permethrin resistance mutation foundthroughout Africa. Currently there are two main PCR assays to detect the West and East African forms(Martinez-Torres et al. 1998; Ranson et al. 2000). An RT-PCR based assay can be found in Chapter8.5.1.3.PCR authentication for KDR resistance in An. gambiaePrepare PCR Master Mix for 96, 48 or 1 25 μl PCR reactions. Add reagents in the order presented.96 48 1 Reagent1710 μl 855 μl 17.1 μl sterile H 2 O250 μl 125 μl 2.5 μl 10X PCR Buffer100 μl 50 μl 1.0 μl dNTP (2.5 mM mix)100 μl 50 μl 1.0 μl AgD1 (2.5 pmol/μl) [ATAGATTCCCCGACCATG]100 μl 50 μl 1.0 μl AgD2 (2.5 pmol/μl) [AGACAAGGATGATGAACC]100 μl 50 μl 1.0 μl AgD3 (2.5 pmol/μl) [AATTTGCATTACTTACGACA]100 μl 50 μl 1.0 μl AgD4 (2.5 pmol/μl) [CTGTAGTGATAGGAAATTTA]30 μl 15 μl 0.3 μl MgCl 2 (25 mM)12.5 μl 6.25 μl 0.125 μl Taq DNA polymerase (5 U/μl)2.5 ml 1.25 ml 25 μl TotalTable 5.3.1.1. PCR for West African KDR resistance mechanism.Prepare PCR Master Mix for 96, 48 or 1 25 μl PCR reactions. Add reagents in the order presented.96 48 1 Reagent1710 μl 855 μl 17.1 μl sterile H 2 O250 μl 125 μl 2.5 μl 10X PCR Buffer100 μl 50 μl 1.0 μl dNTP (2 mM mix)100 μl 50 μl 1.0 μl AgD1 (2.5 pmol/μl) [ATAGATTCCCCGACCATG]100 μl 50 μl 1.0 μl AgD2 (2.5 pmol/μl) [AGACAAGGATGATGAACC]100 μl 50 μl 1.0 μl AgD4 (2.5 pmol/μl) [CTGTAGTGATAGGAAATTTA]100 μl 50 μl 1.0 μl AgD5 (2.5 pmol/μl) [TTTGCATTACTTACGACTG]30 μl 15 μl 0.3 μl MgCl 2 (25 mM)12.5 μl 6.25 μl 0.125 μl Taq DNA polymerase (5 U/μl)2.5 ml 1.25 ml 25 μl TotalTable 5.3.1.2. PCR for East African KDR resistance mechanism.PCR Cycle sequence (for both East and West versions):94°C/5min x 1 cycle(94°C/1min, 48°C/2min, 72°C/2min) x 40 cycles72°C/10min x 1 cycle4°C holdRun samples on a 2% agarose EtBr gel; load 5 μl sample.Primers create fragments of 293 internal control, 195 resistant, 137 susceptible. (Figure 5.3.1.1).