Methods in Anopheles Research - MR4

Chapter 5 : Insecticide Resistance Monitoring5.3 Insecticide Resistance Allele Assay by PCR5.3.3 Dieldrin Resistance – Anopheles gambiae and An. arabiensisPage 1 of 45.3.3 Dieldrin Resistance - An. gambiae and An. arabiensisIntroductionDue to the ban on the use of dieldrin as an insecticide, resistance to dieldrin (Rdl) is not prevalent in thewild; however, several laboratory colonies are maintained that have this mutation. The Rdl mutation hasbeen found to be associated with cross-resistance to newer insecticides that are currently beingemployed (Brooke et al. 2000; Kolaczinski and Curtis 2001). Two PCR assays have been developed todetect the Rdl mutation; one in An. gambiae (Du et al. 2005) and one in An. arabiensis (Wilkins et al.2006). An RT-PCR based assay can be found in Chapter 8.5.1.5.An. gambiae (Du et al. 2005)Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. Add reagents in the order presented.96 48 1 Reagent1555 μl 777.5 μl 15.55 μl sterile H 2 O500 μl 250 μl 5.0 μl 5X GoTaq PCR Buffer100 μl 50 μl 1.0 μl dNTP (2.5 mM mix)100 μl 50 μl 1.0 μl RDLF (F, 25 pmol/µl) [AGTTGGTACGTTCGATGGGTTA]100 μl 50 μl 1.0 μl RDLR (R, 25 pmol/μl) [CCAGCAGACTGGCAAATACC]100 μl 50 μl 1.0 μl DF1RDL (F, 25 pmol/μl) [AATGCTACACCAGCACGTGTTGG]30 μl 15 μl 0.3 μl MgCl 2 (25 mM)15 μl 7.5 μl 0.15 μl Go-Taq DNA polymerase (5 U/μl)2.5 ml 1.25 ml 25 μl TotalTable 5.3.3.1. F and R indicate forward and reverse orientation. Use 1 μl DNA template.An. arabiensis (Wilkins et al. 2006)Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. Add reagents in the order presented.96 48 1 Reagent1455 μl 727.5 μl 14.55 μl sterile H 2 O500 μl 250 μl 5.0μl 5X PCR Buffer100 μl 50 μl 1.0 μl dNTP (2 mM mix)100 μl 50 μl 1.0 μl RDLF (F, 25 pmol/µl) [AGTTGGTACGTTCGATGGGTTA]100 μl 50 μl 1.0 μl RDLR (R, 25 pmol/μl) [CCAGCAGACTGGCAAATACC]100 μl 50 μl 1.0 μl AARDL (F, 25 pmol/μl) [GCTACACCAGCACGTGaTT]100 μl 50 μl 1.0 μl RDLSS (R, 25 pmol/µl) [CAAGACAGTAGTTACACCTAAaGC]30 μl 15 μl 0.3 μl MgCl 2 (25 mM)15 μl 7.5 μl 0.15 μl Go-Taq DNA polymerase (5 U/μl)2.5 ml 1.25 ml 25 μl TotalTable 5.3.3.2. In primer sequence, lower case nucleotides indicates the intentional mismatch, nucleotidesin bold are located at site of SNP (where applicable); F and R indicate forward and reverse orientation.Use 1 μl DNA template.