Methods in Anopheles Research - MR4

Chapter 8 : Field Techniques8.3 Molecular Identification of Mammalian Blood Meals from MosquitoesPage 1 of 48.3 Molecular Identification of Mammalian Blood Meals fromMosquitoesChristen M Fornadel, Rebekah J Kent, Douglas E NorrisIntroductionIdentification of blood meals is an important step in understanding mosquito ecology. The followingprotocol was developed to differentiate between a select group of potential mammal host bloods inengorged anophelines, but may be adapted or expanded to suit particular needs (i.e. most often anexpanded or altered host list). This protocol was designed for use on genomic DNA extractions ofmosquito abdomens.Initial Blood Meal Identification PCR (Kent and Norris 2005; Kent et al. 2007)This multiplexed PCR produces species-specific fragments of varying sizes amplified from thecytochrome b gene, encoded in the mitochondrial genome. Host DNA is detectable up to 24-30 hourspost feeding.Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. 1 Add reagents in the order presented.96 48 1 Reagent Product size (bp)1.83 ml 915 μl 18.3 μl sterile H2O250 μl 125 μl 2.5 μl Taq 10X PCR Buffer with MgCl2100 μl 50 μl 1.0 μl dNTP (final concentration of 100 μM of each dNTP)50 μl 25 μl 0.5 μl UnRev1025 (50 pmol/μl) [ggttg[t/g]cctccaattcatgtta]50 μl 25 μl 0.5 μl Pig573F (50 pmol/μl) [cctcgcagccgtacatctc] 45350 μl 25 μl 0.5 μl Human741F (50 pmol/μl) [ggcttacttctcttcattctctcct] 33450 μl 25 μl 0.5 μl Goat894F (50 pmol/μl) [cctaatcttagtacttgtacccttcctc] 13250 μl 25 μl 0.5 μl Dog368F (50 pmol/μl) [ggaattgtactattattcgcaaccat] 68050 μl 25 μl 0.5 μl Cow121F (50 pmol/μl) [catcggcacaaatttagtcg] 56120 μl 10 μl 0.2 μl Taq DNA polymerase (5 U/μl)2.5 ml 1.25 ml 25 μl TotalFor DNA template use up to 3 µl DNA sample (from abdomen extraction eluted in 50μl dH 2 0)PCR Cycle conditions95°C/5min x 1 cycle(95°C/60sec , 56°C/60sec , 72°C/60sec) x 40 cycles72°C/7min x 1 cycle4°C hold1 Amounts for larger master mixes have been adjusted upwards to be sufficient for 50 and 100 reactionsto compensate for imprecise measurements.