Methods in Anopheles Research - MR4

More documents

Recommendations

Info

Chapter 8 : Field Techniques8.4 Species Complex Authentication by PCR8.4.8 Anopheles quadrimaculatus Complex – Levine et al.Page 1 of 28.4.8 Anopheles quadrimaculatus Species Complex (Levine et al.)Mark BenedictIntroductionThough malaria is no longer endemic in the United States, the competent vector An. quadrimaculatus isstill present. It has been determined that the An. quadrimaculatus complex is made up of at least fivemembers: An. inundatus, An. diluvialis, An. maverlius, An. smaragdinus, and An. quadrimaculatus(Narang et al. 1990). A PCR based on SNPs in the internal transcribed spacer region was developed forAn. quadrimaculatus that can distinguish the various members of the complex (Cornel et al. 1996),however a later modification was developed that uses primers that have similar 60°C annealingtemperatures and the concentrations recommended are the same as one another (Levine et al. 2004).Fragment sizes are also slightly more distinct (Figure 4.2.6.1).PCR authentication for the members of the Anopheles quadrimaculatus complex (Cornel et al.1996)Prepare PCR Master Mix for 96, 48 or 1 25 μl PCR reactions. 1 Add reagents in the order presented.96 48 1 Reagent380 μl 190 μl 3.5 μl sterile H 2 O250 μl 125 μl 2.5 μl 10X Promega Taq PCR Buffer w/o MgCl 2250 μl 125 μl 2.5 μl dNTP (2 mM mix each G,A,T,C)250 μl 125 μl 2.5 µl MgCl 2 (32 mM)250 μl 125 μl 2.5 μl AquadU-2 (F, 10 pmol/μl) [GTGCGACACAGCTCGATG]250 μl 125 μl 2.5 μl AquadQ-2 (R, 10 pmol/μl) [CCGTAGGAGGCTGCATTTTA]250 μl 125 μl 2.5 μl AquadS-2 (R, 10 pmol/μl) [GAACACACTACACAACACGCTTT]250 μl 125 μl 2.5 μl AquadD1-2 (R, 10 pmol/μl) [AGGCCCATGTACTCCGTAGG]250 μl 125 μl 2.5 μl AQD (R, 10 pmol/μl) [ATGCAAAAGGTGGTGTTGTG]20 μl 10 μl 0.5 μl Taq DNA polymerase (5U/μl)2.4 ml 1.2 ml 24 μl Total (To each 24 ul reaction add 1 μl template DNA)Table 8.4.8.1. F and R indicate forward and reverse orientation. Use 1 μl DNAtemplate. If all primers are not used, complete the volume with water.PCR cycle conditions95°C / 2min x 1 cycle(95°C / 30s, 57°C / 30s, 72°C / 30s) x 30 cycles4°C holdRun samples on a 2% agarose EtBr gel; load 5 μl sample.Primers create fragments of 321 bp for An. quadrimaculatus, 233 bp forAn. smaragdinus, 353 bp for An. diluvialis, 365 for An. inundatus and 141bp forFigure 8.4.8.1. PCRproducts obtained fromamplification of A.quadrimaculatus s.s.(Q), A. smaragdinus(S), A. diluvialis (D)and A. maverlius (M)1 Amounts for larger master mixes have been adjusted upwards to be sufficient for 50 and 100 rxnscompensate for imprecise measurements.
Chapter 8 : Field Techniques8.4 Species Complex Authentication by PCR8.4.8 Anopheles quadrimaculatus Complex – Levine et al.Page 2 of 2An. maverlius.ReferencesCornel AJ, Porter CH, Collins FH (1996) Polymerase chain reaction species diagnostic assay forAnopheles quadrimaculatus cryptic species (Diptera: Culicidae) based on ribosomal DNA ITS2sequences. J Med Entomol 33:109-116Levine RS, Peterson AT, Benedict MQ (2004) Distribution of members of Anopheles quadrimaculatusSay s.l. (Diptera: Culicidae) and implications for their roles in malaria transmission in the United States. JMed Entomol 41:607-613Narang SK, Seawright JA, Kaiser PE (1990) Evidence for microgeographic genetic subdivisions ofAnopheles quadrimaculatus species C. J Am Mosq Control Assoc 6:179-18796 well sample preparation template
Page 1:
\Methods inAnopheles ResearchSecond
Page 8 and 9:
Preface to Second EditionWhen Mark
Page 10 and 11:
Chapter 1 : Insectary Operation1.1
Page 12 and 13:
Page 14 and 15:
Page 16 and 17:
Page 19 and 20:
Page 21 and 22:
Page 23 and 24:
Page 25 and 26:
Page 27 and 28:
Page 29 and 30:
Page 31 and 32:
Page 33 and 34:
Page 35 and 36:
Chapter 2 : Anopheles Laboratory Bi
Page 37 and 38:
Page 39 and 40:
Page 41 and 42:
Page 43 and 44:
Page 45 and 46:
Page 47 and 48:
Page 49 and 50:
Page 51 and 52:
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64:
Page 65 and 66:
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
Page 77 and 78:
Page 79 and 80:
Page 81 and 82:
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Chapter 2 : Anopheles Biology Labor
Page 95 and 96:
Page 97 and 98:
Page 99 and 100:
Page 101 and 102:
Page 103 and 104:
Page 105 and 106:
Page 107 and 108:
Chapter 3 : Specific Anopheles Tech
Page 109 and 110:
Page 111 and 112:
Page 113 and 114:
Page 115 and 116:
5. Place eggs in a new Petri dish c
Page 117 and 118:
Page 119 and 120:
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
Page 141 and 142:
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
Page 149 and 150:
Page 151 and 152:
Page 153 and 154:
Page 155 and 156:
Page 157 and 158:
Page 159 and 160:
Chapter 4 : Stock Authentication4.1
Page 161 and 162:
Page 163 and 164:
Page 165 and 166:
Page 167 and 168:
Page 169 and 170:
Figure 4.2.3.1 Lane 1 1kb ladder, l
Page 171 and 172:
Chapter 5 : Insecticide Resistance
Page 173 and 174:
Page 175 and 176:
Page 177 and 178:
INTRODUCTIONChapter 5 : Insecticide
Page 179 and 180:
Chapter 5 : Insecticide Resistance5
Page 181 and 182:
Page 183 and 184:
Page 185 and 186:
Page 187 and 188:
Page 189 and 190:
Page 191 and 192:
Page 193 and 194:
Page 195 and 196:
Page 197 and 198:
Page 199 and 200:
Page 201 and 202:
Page 203 and 204:
Page 205 and 206:
Page 207 and 208:
Page 209 and 210:
Page 211 and 212:
Page 213 and 214:
Page 215 and 216:
Page 217 and 218:
Page 219 and 220:
Page 221 and 222:
Page 223 and 224:
Page 225 and 226:
Chapter 6 : Dissection Techniques6.
Page 227 and 228:
Figure 6.2.1. Larval mosquito midgu
Page 229 and 230:
Page 231 and 232:
Page 233 and 234:
Page 235 and 236:
Page 237 and 238:
Page 239 and 240:
Page 241 and 242:
Page 243 and 244:
Page 245 and 246:
Page 247 and 248:
Page 249 and 250:
Page 251 and 252:
Page 253 and 254:
Chapter 7 : Taxonomy and Systematic
Page 255 and 256:
Page 257 and 258:
Page 259 and 260:
Page 261 and 262: Chapter 7 : Taxonomy and Systematic
Page 265 and 266: Collection NumberCountryNumber Le P
Page 267 and 268: MOSQUITO BITING COLLECTION RECORDCo
Page 279 and 280: Chapter 8 : Field Techniques8.1 Mol
Page 283 and 284: Chapter 8 : Field Techniques8.2 Pla
Page 299 and 300: Chapter 8 : Field Techniques8.4 Spe
Page 311: Chapter 8 : Field Techniques8.4 Spe
Page 315 and 316: Chapter 8 : Field Techniques8.5 Rea
Page 325 and 326: 20Chapter 8 : Field Techniques8.5 R
Page 331 and 332: 8070Mutant (S1014)Chapter 8 : Field
Page 335 and 336: AChapter 8 : Field Techniques8.5 Re
Page 341 and 342: Chapter 9 : Obtaining Live Material
Page 343: Chapter 9 : Obtaining Live Material
show all

Methods in Anopheles Research - MR4

Create successful ePaper yourself

Delete template?

Save as template?