Methods in Anopheles Research - MR4

Chapter 8 : Field Techniques8.4 Species Complex Authentication by PCR8.4.3 Combined An. gambiae complex and ribosomal DNA type assay for M/S discriminationPage 1 of 28.4.3 Combined An. gambiae complex and ribosomal DNA type assay forM/S discriminationLiz WilkinsIntroductionThe Wilkins et al. (2006) method of Anopheles gambiae complex discrimination is based on speciesspecificsingle nucleotide polymorphisms (SNPs) in the intergenic spacer region (IGS) (section 8.4.1). Wehave added primers to this method to simultaneously elucidate the Ribosomal DNA type. Theseadditional primers also incorporate the intentional mismatches into the primers (Intentional MismatchPrimers (IMPs)) to increase the specificity (Wilkins et al. 2006). An RT-PCR based method is alsoavailable in Chapter 8.5.1.1.PCR authentication for the members of the Anopheles gambiae complex (Wilkins et al. 2006) withadditional primers for Ribosomal DNA typePrepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. 1 Add reagents in the order presented.96 48 1 Reagent910 μl 455 μl 9.1 μl sterile H 2 O500 μl 250 μl 5.0 μl 5X GoTaq PCR Buffer250 μl 125 μl 2.5 μl dNTP (2.5 mM mix)30 μl 15 μl 0.3 μl MgCl 2 (25mM)100 μl 50 μl 1.0 μl IMP-UN (F, 25pmol/μl) [GCTGCGAGTTGTAGAGATGCG]100 μl 50 μl 1.0 μl AR-3T (R, 25pmol/μl) [GTGTTAAGTGTCCTTCTCCgTC]100 μl 50 μl 1.0 μl GA-3T (R, 25pmol/μl) [GCTTACTGGTTTGGTCGGCAtGT]100 μl 50 μl 1.0 μl ME-3T (R, 25pmol/μl) [CAACCCACTCCCTTGACGaTG]200 μl 100 μl 2.0 μl QD-3T (R, 25pmol/μl) [GCATGTCCACCAACGTAAAtCC]100 μl 50 μl 1.0 μl IMP-S1 (R, 25pmol/μl) [CCAGACCAAGATGGTTCGcTG]100 μl 50 μl 1.0 μl IMP-M1 (R, 25pmol/μl) [TAGCCAGCTCTTGTCCACTAGTtTT]15 μl 7.5 μl 0.15 μl Go-Taq DNA polymerase2.5 ml 1.25 ml 25 μl Total (To each 25 μl reaction add 1 μl template DNA)Table 8.4.2.1. Lower case nucleotides indicates the intentional mismatch in the primer sequences.Nucleotides in bold are located at site of SNP (where applicable), F and R indicate forward and reverseorientation. Use 1 μl DNA template. Improved specificity can be achieved by eliminating primers forspecies not found in the sampling area. Add water to compensate for this volume if all are not included.PCR cycle conditions95°C/5min x 1 cycle(95°C/30sec , 58°C/30sec , 72°C/30sec) x 30 cycles72°C/5min x 1 cycle4°C holdRun samples on a 2% agarose EtBr gel; load 5 μl sample.1 Amounts for larger master mixes have been adjusted upwards to be sufficient for 50 and 100 rxnscompensate for imprecise measurements.