Impact des mÃ©taux lourds sur les interactions plante/ver de terre ...

More documents

Recommendations

Info

Partie B : Matériel et MéthodesAmorce Séquence (5’→ 3’) Référence*338f GAC TCC TAC GGG AGG CAG CAG Lane et al. (1991)518 ATT ACC GCG GCT GCT GG Muyzer et al. (1993)**rpoB1698f AAC ATC GGT TTG ATC AAC Dahllöf et al. (2000)rpoB2041r CGT TGC ATG TTG GTA CCC AT Dahllöf et al. (2000)*gc clamp 5’- CGC CCG GGG CGC GCC CCG GGC GGG GCG GGG GCA CGG GGG G - 3’**gc clamp 5’- CGC CCC CCG CGC CCC GCG CCC GGC CCG CCG CCC CCG CCC C - 3’Tableau 5A : Amorces utilisées pour l’amplification de l’ADNr bactérientel-00486649, version 1 - 26 May 2010Amorce Séquence (5’→ 3’) Référence403f GTG AAA TTG TTG TTG AAA GGG AA Sandhu et al. (1995)662r GGA CTC CTT GGT CCG TGT T Sandhu et al. (1995)*ITS1 TCC GTA GGT GAA CCT GCG G White et al. (1990)ITS4 TCC TCC GCT TAT TGA TAT GC White et al. (1990)*gc clamp 5’- CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGG -3’gc clamp attaché à l’extrémité 5’ de la séquence du primer (Sheffield et al., 1992)Tableau 5B : Amorces utilisés pour l’amplification de l’ADNr fongique46
Partie B : Matériel et MéthodesCouple d’amorce Etape d’amplification Température (°C) Temps Nombre de cyclesDénaturation initiale 94 5 min338f/518rDénaturationHybridationElongation9465721 min1 min3 minElongation final 72 10 minDénaturation initiale 94 5 min30tel-00486649, version 1 - 26 May 2010Dénaturation9460 secHybridation4090 sec101698f/2041rElongation72120 secDénaturation9460 secHybridation5090 secElongation72120 sec25Elongation final 72 15 minTableau 6A : Conditions d’amplification par Polymerase Chain Reaction (PCR) pour les bactériesCouple d’amorce Etape d’amplification Température (°C) Temps Nombre de cyclesDénaturation initiale 94 5 minDénaturation9445 sec403f/662r Hybridation6045 sec30Elongation721 minElongation final 72 30 minITS1/ITS4Dénaturation initiale 94 30 secDénaturation9430 secHybridation501 minElongation722 minElongation final 72 10 min35Tableau 6B : Conditions d’amplification par Polymerase Chain Reaction (PCR) pour les champignons47
Page 7 and 8: tel-00486649, version 1 - 26 May 20
Page 9 and 10: 4. Discussion…………………
Page 13 and 14: Introduction généraledifférentes
Page 15 and 16: Partie A : Synthèse bibliographiqu
Page 41 and 42: Partie B : Matériel et MéthodesI/
Page 43 and 44: Partie B : Matériel et MéthodesPo
Page 45 and 46: Partie B : Matériel et MéthodesII
Page 47 and 48: Partie B : Matériel et MéthodesPo
Page 49 and 50: Partie B : Matériel et MéthodesFi
Page 51 and 52: Partie B : Matériel et MéthodesV/
Page 53 and 54: Partie B : Matériel et MéthodesV.
Page 55 and 56: Partie B : Matériel et Méthodessp
Page 57: Partie B : Matériel et MéthodesL
Page 61 and 62: Partie C : Résultatstel-00486649,
Page 63 and 64: Partie C : Résultats - Chapitre C-
Page 67 and 68: iomasse sec (g)Partie C : Résultat
Page 97 and 98: Activité enzymatiqueActivité enzy
Page 105 and 106: AgV/T/SVS /T/SVAgP/T/SPS/T/SPAgP/T/
Page 109 and 110:
AgPTSP1AgPTSP2AgPTSP3AgPTSPV1AgPTSP
Page 111 and 112:
AWCDPartie C : Résultats - Chapitr
Page 113 and 114:
Partie C : Résultats - Chapitre C-
Page 115 and 116:
Page 117 and 118:
Page 119 and 120:
Nombre morphologiePartie C : Résul
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Page 131 and 132:
Partie D : Discussion - Conclusion
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
RéférencesAAbbass, M.I. and Razak
Page 139 and 140:
Référencestel-00486649, version 1
Page 141 and 142:
Page 143 and 144:
Page 145 and 146:
RéférencesGregory, P.J. (2006). R
Page 147 and 148:
RéférencesJiménez, J.J., Cepeda,
Page 149 and 150:
RéférencesKuperman, R.G., Carreir
Page 151 and 152:
RéférencesLoué, A. (1993). Oligo
Page 153 and 154:
RéférencesNNaidu, R., Bolan, N.S.
Page 155 and 156:
Page 157 and 158:
Page 159 and 160:
RéférencesTorsvik, V., and Øvra
Page 161 and 162:
tel-00486649, version 1 - 26 May 20
Page 163 and 164:
Annexe 2 : Liste de morphologies fo
Page 165 and 166:
tel-00486649, version 1 - 26 May 20
Page 167 and 168:
tel-00486649, version 1 - 26 May 20
Page 169:
SUMMARYtel-00486649, version 1 - 26
show all

Impact des mÃ©taux lourds sur les interactions plante/ver de terre ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?