Cancer du sein et micro-environnement tumoral: rôle de la protéase ...

siRNAs. Duplexes of 21-nucleotide human LRP1 siRNA1 (target sequenceAAGCAGTTTGCCTGCAGAGAT, residues 666-684) (21), human LRP1 siRNA2(target sequence AAGCTATGAGTTTAAGAAGTT) (Dharmacon), mouse LRP1siRNA3 (target sequence AAGCAUCUCAGUAGACUAUCA) (22), mouse LRP1siRNA4 (target sequence AAGCAGTTTGCCTGCAGAGAC) or firefly luciferase (Luc)siRNA (target sequence AACGTACGCGGAATACTTCGA) were synthesized byMWG Biotech S.A. (France) or Dharmacon.GST pull-down assays[ 35 S]methionine-labeled pro-cath-D, LRP1 (1-476) or APP695 were obtained bytranscription and translation using the TNT T7 -coupled reticulocyte lysate system(Promega). GST, GST-LRP1b (307479), GST-LRP1b shorter fragments, GST-cath-D-52K, -34K, -14K and -4K fusion proteins were produced in Escherichia coli B strainBL21 using isopropyl-1-thio-b-D-galactopyranoside (1 mM) for 3 h at 37°C. GSTfusion proteins were purified on glutathione-Sepharose beads (AmershamBiosciences). For pull-down assays, 20-µl bed volume of glutathione-Sepharosebeads with immobilized GST fusion proteins were incubated overnight at 4°C witheither [ 35 S]methionine-labeled proteins in 500 µl PDB buffer (20 mM HEPES-KOH[pH 7.9], 10% glycerol, 100 mM KCl, 5 mM MgCl 2 , 0.2 mM EDTA, 1 mM DTT, 0.2 mMphenylmethylsulfonyl fluoride) containing 15 mg/ml BSA and 0.1% Tween 20. Thebeads were washed with 500 µl PDB buffer, and bound proteins were resolved by15% SDS-PAGE, stained with Coomassie blue, and exposed to autoradiographicfilm. The refolding of GST proteins was performed using a multi-step dialysis protocol6