A new approach to species delimitation in Septoria - CBS - KNAW

More documents

Recommendations

Info

Verkley et al.CaryophyllaceaeRutaceaeAraceaeBrassicaceaeRosaceaePolygonaceaeScrophulariaceaeFabaceaeLamiaceaeRanunculaceaeApiaceaeAsteraceae0.880.572x110.990.812x12x110.792x0.581 Septoria aegopodina CBS 1237400.8Septoria aegopodina CBS 1237410.88 Septoria gentianae CBS 1286331Septoria oenanthicola CBS 1286490.61 Septoria mazi CBS 1286561 Septoria mazi CBS 1287551 1 Septoria sii CBS 118.961 Septoria sii CBS 1023691 Septoria sii CBS 102370Septoria oenanthis CBS 1286670.991 Septoria campanulae CBS 128589Septoria campanulae CBS 1286040.881 Septoria lactucae CBS 352.581 Septoria lactucae CBS 108943Septoria cf. sonchi CBS 128757Septoria dearnessii CBS 128624Cercospora apii CBS 1187120.99Cercospora zebrina CBS 1187901 1Cercospora ariminensis CBS 137.560.8Cercospora beticola CBS 124.310.8Septoria sp. CBS 135474Passalora janseana CBS 145.372x 11 Passalora dioscoreae CBS 1354600.62Passalora dioscoreae CBS 135463Pseudocercosporella magnusiana CBS 114735Passalora sp. CBS 1139981 Passalora sp. CBS 113999Passalora sp. CBS 1142751 Mycosphaerella brassicicola CBS 228.32Mycosphaerella brassicicola CBS 267.530.94 Mycosphaerella capsellae CBS 112032Pseudocercosporella capsellae CBS 127.2911 Pseudocercosporella capsellae CBS 1184120.79Pseudocercosporella capsellae CBS 1120332x1 2xMycosphaerella sp. CBS 135464Passalora depressa CPC 149150.8Pseudocercosporella pastinacae CBS 114116“Septoria” cruciatae CBS 123747“Septoria” cruciatae CBS 123748Passalora fusimaculans CPC 17277Sphaerulina populicola CBS 1000421 Sphaerulina musiva CBS 130559Sphaerulina musiva CBS 13056311Sphaerulina musiva CBS 130562Sphaerulina musiva CBS 1305690.72Sphaerulina frondicola CBS 391.59Sphaerulina quercicola CBS 663.941 Sphaerulina quercicola CBS 1090090.74Sphaerulina quercicola CBS 1150162xSphaerulina quercicola CBS 115136Sphaerulina aceris CBS 183.971 Sphaerulina aceris CBS 652.85Sphaerulina aceris CBS 687.94Sphaerulina amelanchier CPC 231060.82 Sphaerulina amelanchier CBS 1351100.9 Sphaerulina amelanchier CPC 231051 Sphaerulina rhabdoclinis CBS 102195Sphaerulina sp. CBS 1020630.69 Sphaerulina sp. CPC 23107Sphaerulina gei CBS 1023181 1Sphaerulina gei CBS 128616Sphaerulina gei CBS 128632Sphaerulina viciae CBS 1318981 Sphaerulina cercidis CBS 128634Sphaerulina cercidis CBS 1189101 Sphaerulina cercidis CBS 12915110.54 Sphaerulina cercidis CBS 501.500.65 Sphaerulina sp. CBS 1287580.791 Sphaerulina patriniae CBS 128653Sphaerulina patriniae CBS 12915311 Sphaerulina menispermi CBS 1286661Sphaerulina menispermi CBS 128761Sphaerulina hyperici CBS 1023131 1 Sphaerulina azaleae CBS 352.490.89 Sphaerulina azaleae CBS 128605Sphaerulina berberidis CBS 324.520.831 Sphaerulina tirolensis CBS 109018Sphaerulina tirolensis CBS 10901711 Sphaerulina socia CBS 355.58Sphaerulina socia CBS 357.580.82Sphaerulina betulae CBS 1167241 Sphaerulina betulae CBS 128597Sphaerulina betulae CBS 1286001Sphaerulina betulae CBS 1285961Sphaerulina westendorpii CBS 1090021 Sphaerulina westendorpii CBS 117478Sphaerulina westendorpii CBS 102327Sphaerulina cornicola CBS 102324Sphaerulina cornicola CBS 102332Sphaerulina cornicola CBS 116778Sphaerulina abeliceae CBS 1285911 Caryophylloseptoria spergulae CBS 397.520.96 Caryophylloseptoria spergulae CBS 1090101 Caryophylloseptoria pseudolychnidis CBS 1286300.97 Caryophylloseptoria pseudolychnidis CBS 128614Caryophylloseptoria lychnidis CBS 1090981 Caryophylloseptoria lychnidis CBS 1090991Caryophylloseptoria lychnidis CBS 109101Caryophylloseptoria lychnidis CBS 1091021 Caryophylloseptoria silenes CBS 109100Caryophylloseptoria silenes CBS 1091031 “Septoria” gladioli CBS 121.20“Septoria” gladioli CBS 353.29Cercosporella virgaureae CBS 113304Pseudocercospora flavomarginata CBS 1249901 Pseudocercospora tereticornis CBS 1249961 Pseudocercospora pyracanthigena CPC 108080.97 Pseudocercospora schizolobii CBS 120029Pseudocercospora rhoina CPC 114640.82Pseudocercospora madagascariensis CBS 124155“Septoria” oudemansii CBS 619.721 Dothistroma pini CBS 121011Dothistroma septospora CBS 383.74Passalora dissiliens CBS 219.771Ramularia endophylla CBS 1132651Ramularia eucalypti CBS 120726Ramularia lamii CPC 113121 Zymoseptoria brevis CPC 181021 Zymoseptoria brevis CPC 181071 1 Zymoseptoria tritici CBS 392.59Zymoseptoria tritici CPC 18099Zymoseptoria halophila CBS 128854Readeriella mirabilis CBS 1250000.2321Septoria(cont.)CercosporaIncertae sedisPseudocercosporapseudocercosporellalikeSphaerulinaCaryophylloseptoriaseptoria-likeCercosporellaIncertae sedisDothistromaIncertae sedisRamulariaZymoseptoriaReaderiellaFig. 2. (Continued).232
A new approach to species delimitation in SeptoriaTable 2. Primer combinations used during this study for generic amplification and sequencing.Locus Primer Primer sequence 5’ to 3’: Annealing Orientation Referencetemperature(°C)Translation elongation factor-1α EF1-728F CATCGAGAAGTTCGAGAAGG 52 Forward Carbone & Kohn (1999)EF-2 GGARGTACCAGTSATCATGTT 52 Reverse O’Donnell et al. (1998)β-tubulin T1 AACATGCGTGAGATTGTAAGT 52 Forward O’Donnell & Cigelnik (1997)β-Sandy-R GCRCGNGGVACRTACTTGTT 52 Reverse Stukenbrock et al. (2012)RNA polymerase II second largest subunit fRPB2-5F GAYGAYMGWGATCAYTTYGG 49 Forward Liu et al. (1999)fRPB2-414R ACMANNCCCCARTGNGWRTTRTG 49 Reverse Quaedvlieg et al. (2011)LSU LSU1Fd GRATCAGGTAGGRATACCCG 52 Forward Crous et al. (2009a)LR5 TCCTGAGGGAAACTTCG 52 Reverse Vilgalys & Hester (1990)ITS ITS5 GGAAGTAAAAGTCGTAACAAGG 52 Forward White et al. (1990)ITS4 TCCTCCGCTTATTGATATGC 52 Reverse White et al. (1990)Actin ACT-512F ATGTGCAAGGCCGGTTTCGC 52 Forward Carbone & Kohn (1999)ACT2Rd ARRTCRCGDCCRGCCATGTC 52 Reverse Groenewald et al. (2012)Calmodulin CAL-235F TTCAAGGAGGCCTTCTCCCTCTT 50 Forward Quaedvlieg et al. (2012)CAL2Rd TGRTCNGCCTCDCGGATCATCTC 50 Reverse Groenewald et al. (2012)Table 3. Amplification success, phylogenetic data and the substitution models used in the phylogenetic analysis, per locus.Locus Act Cal EF1 RPB2 Btub ITS LSUAmplification succes (%) 99 100 100 97 100 100 100Number of characters 304 601 619 354 565 574 853Unique site patterns 234 407 507 198 380 261 147Substitution model used GTR-I-gamma HKY-I-gamma GTR-I-gamma GTR-I-gamma HKY-I-gamma GTR-I-gamma GTR-I-gammaNumber of generations (1000×) 10 197Total number of trees (n) 22 962Sampled trees (n) 17 222In clade 5 (92 %, 63 strains) of the main Septoria clade twomain clusters are found. At the base of the subclade 5a (77 %, 52strains), two strains of S. clematidis (CBS 108983–4) and Septoriasp. (CPC 19716) originating from Searsia laevigatum in SouthAfrica. This cluster furthermore comprises three strains isolatedfrom Hibiscus spp., viz., S. hibiscicola (CBS 128611, 128615) and S.abei (CBS 128598), and two main groups, one with S. anthurii (CBS148.41, 346.58), S. sisyrinchii (CBS 112096), the Chromolaenafungi S. chromolaenae (CBS 113373) and S. ekmanniana (CBS113385, 113612), and S. passiflorae (CBS 102701) and S.passifloricola (CBS 129431), and a second group comprising atthe base S. eucalyptorum (CBS 118505; Crous et al. 2006b), andfurthermore S. justiciae (CBS 128610, 128625, and CPC 12509),S. linicola (CBS 316.37), S. cucubali (3 strains, including CBS124874, an endophytic isolate from Fagus leaf litter), S. lepidiicola(CBS 128635) and and a partially unresolved cluster of 23 strainscomprising the plurivorous S. protearum and S. citri complex. Asmall well-supported cluster (100 %) contains S. verbenae (CBS113438, 113481), two unidentified species of Septoria (CPC 19304,from Vigna unguiculata subsp. sesquipedalis and CPC 19793, fromSyzygium cordatum), and M. coacervata (CBS 113391). Subclade5b (100 %, 11 strains) comprises S. helianthicola (CBS 122.81),three strains of S. stellariae, CBS 503.76 identified as S. acetosae,three strains of S. astragali, “Cercospora sp.” (CBS 112737), andfurthermore S. hippocastani (CBS 411.61 and MP11).Examining the distribution of host families throughout the tree,an interesting disjunct pattern is found for the families that arerepresented by more than a few specimens (see legend in Fig. 2).For example, the 28 species infecting Asteraceae are found in allclades and most subclades of the tree, including Sphaerulina; ninespecies infecting Apiaceae are found in clade 3 and subclades4a–d of Septoria; 10 species of Rosaceae in Septoria clades 4, 5and Sphaerulina (clades 1 and 2); six species infecting Lamiaceaeare dispersed in subclades 4b, c, and d-1.TAXONOMYCaryophylloseptoria Verkley, Quaedvlieg & Crous, gen.nov. MycoBank MB804469.Etymology: Named after the plant family on which these taxa occur,Caryophyllaceae.Conidiomata pycnidial, epiphyllous or predominantly epiphyllous,globose to subglobose, or slightly depressed, with a centralostiolum. Conidiomatal wall composed of textura angularis orglobulosa-angularis. Conidiogenous cells hyaline, holoblastic,proliferating percurrently 1–many times with indistinct annellations,www.studiesinmycology.org233
Page 1 and 2: Studies in Mycology 75: 213-305.A n
Page 3 and 4: A new approach to species delimitat
Page 15: A new approach to species delimitat
Page 18 and 19: Verkley et al.CaryophyllaceaeRutace
Page 22 and 23: Verkley et al.Fig. 3. Caryophyllose
Page 35: A new approach to species delimitat
Page 38 and 39: Verkley et al.wk (15-18 mm in 7 wk)
Page 40 and 41: Verkley et al.Conidiomata simple or
Page 42 and 43: Verkley et al.Fig. 16. Septoria cuc
Page 44 and 45: Verkley et al.Fig. 17. Septoria dig
Page 46 and 47: Verkley et al.Baarnsche bos, ex lea
Page 48 and 49: Verkley et al.Septoria galeopsidis
Page 50 and 51: Verkley et al.already considered th
Page 52 and 53: Verkley et al.Fig. 23. Septoria lac
Page 54 and 55: Verkley et al.much more profound di
Page 56 and 57: Verkley et al.Fig. 26. Septoria lyc
Page 58 and 59: Verkley et al.Fig. 27. Septoria lys
Page 60 and 61: Verkley et al.to very dark dull gre
Page 62 and 63: Verkley et al.Fig. 30. Septoria nap
Page 64 and 65: Verkley et al.Fig. 31. Septoria par
Page 66 and 67: Verkley et al.Fig. 32. Septoria pet
Page 68 and 69: Verkley et al.Fig. 34. Septoria pol
Page 70 and 71:
Verkley et al.CBS 179.77; same area
Page 72 and 73:
Verkley et al.0(-9-11?)-septate con
Page 74 and 75:
Verkley et al.to 60 µm diam, lacki
Page 76 and 77:
Verkley et al.Fig. 38. Septoria sis
Page 78 and 79:
Verkley et al.on OA, but olivaceous
Page 80 and 81:
Verkley et al.Fig. 41. Septoria urt
Page 82 and 83:
Verkley et al.ampulliform to almost
Page 84 and 85:
Verkley et al.diam; Conidiogenous c
Page 86:
Verkley et al.Notes: The type mater
Page 89 and 90:
A new approach to species delimitat
Page 91 and 92:
Page 93:
show all

A new approach to species delimitation in Septoria - CBS - KNAW

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?