Ecole Nationale Supérieure Agronomique de Montpellier ... - CIAM

More documents

Recommendations

Info

time PCR assay for the quantification of apple proliferation phytoplasmas in plants and insects. Acta Horticulturae 657:415-420. Kison, H., B. C. Kirkpatrick, and E. Seemuller. 1997. Genetic comparison of the peach yellow leaf roll agent with European fruit tree phytoplasmas of the apple proliferation group. Plant Pathology 46 (4):538-544. Kison, H., and E. Seemüller. 2001. Differences in strain virulence of the European stone fruit yellows phytoplasma and susceptibility of stone fruit trees on various rootstocks to this pathogen. Journal of Phytopathology 149 (9):533-541. Lee, I. M., A. Bertaccini, M. Vibio, and D. E. Gundersen. 1995. Detection of multiple phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopathology 85 (6):728-735. Lorenz, K. H., F. Dosba, C. Poggi Pollini, G. Llacer, and E. Seemuller. 1994. Phytoplasma diseases of Prunus species in Europe are caused by genetically similar organisms. Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz 101 (6):567-575. Lorenz, K. H., B. Schneider, U. Ahrens, and E. Seemuller. 1995. Detection of the apple proliferation and pear decline phytoplasmas by PCR amplification of ribosomal and nonribosomal DNA. Phytopathology 85 (7):771-776. Maixner, M., U. Ahrens, and E. Seemuller. 1995. Detection of the German grapevine yellows (Vergilbungskrankheit) MLO in grapevine, alternative hosts and a vector by a Specific PCR procedure. European Journal of Plant Pathology 101 (3):241-250. Malisano, G., G. Firrao, and R. Locci. 1996. 16S rDNA-derived oligonucleotide probes for the differential diagnosis of plum leptonecrosis and apple proliferation phytoplasmas. Bulletin OEPP 26 (2):421-428. Marcone, C., and E. Seemuller. 2001. A chromosome map of the European stone fruit yellows phytoplasma. Microbiology Reading 147 (5):1213-1221. Marzachi, C., F. Veratti, and D. Bosco. 1998. Direct PCR detection of phytoplasmas in experimentally infected insects. Annals of Applied Biology 133 (1):45-54. Miquelis, A., J. F. Martin, E. W. Carson, G. Brun, and A. Gilles. 2000. Performance of 18S rDNA helix E23 for phylogenetic relationships within and between the Rotifera-Acanthocephala clades. Comptes Rendus de l'Academie des Sciences, Série III 323 (10):925-941. Morvan, G. 1957. Mise en évidence de l'action d'un virus dans le dépérissement de l'abricotier. Comptes Rendus de l'Academie d'Agriculture de France 43:13-14. Seemüller, E., C. Marcone, U. Lauer, A. Ragozzino, and M. Goschl. 1998. Current status of molecular classification of the phytoplasmas. Journal of Plant Pathology 80 (1):3-26. Seemüller, E., and B. Schneider. 2004. 'Candidatus Phytoplasma mali', 'Candidatus Phytoplasma pyri' and 'Candidatus phytoplasma prunorum', the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively. International Journal of Systematic and Evolutionary Microbiology 54:1217-1226. Skrzeczkowski, L. J., W. E. Howell, K. C. Eastwell, and T. D. Cavileer. 2001. Bacterial sequences interfering in detection of phytoplasma by PCR using primers derived from the ribosomal RNA operon. Acta Horticulturae (550):417-424. Smart, C. D., B. Schneider, C. L. Blomquist, L. J. Guerra, N. A. Harrison, U. Ahrens, K. H. Lorenz, E. Seemuller, and B. C. Kirkpatrick. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S- 23S rRNA spacer region. Applied and Environmental Microbiology 62 (8):2988-2993. Torres, E., M. P. Martin, S. Paltrinieri, A. Vila, R. Masalles, and A. Bertaccini. 2004. Spreading of ESFY phytoplasmas in stone fruit in Catalonia (Spain). Journal of Phytopathology 152 (7):432-437. Tully, J. G., R. F. Whitcomb, D. L. Rose, J. M. Bove, P. Carle, N. L. Somerson, D. L. Williamson, and S. Edengreen. 1994. Acholeplasma brassicae sp. nov. and Acholeplasma palmae sp. nov., 2 non-sterol-requiring mollicutes from plant surfaces. International Journal of Systematic Bacteriology 44 (4):680-684. Wei, W., S. Kakizawa, S. Suzuki, H. Y. Jung, H. Nishigawa, S. Miyata, K. Oshima, M. Ugaki, T. Hibi, and S. Namba. 2004. In planta dynamic analysis of onion yellows phytoplasma using localized inoculation by insect transmission. Phytopathology 94 (3):244-250. - 56 -
Table 1. Sequence of the primers and probes designed to detect or quantify ‘Ca. P. prunorum’ and C. pruni DNA. Name Sequence (5’→ 3’) ‘Ca. P. prunorum’ 16S rDNA ESFYf (forward) CCATCATTTAGTTGGGCACT ESFYr (reverse) ATAGGCCCAAGCCATTATTG ECAQf AAACGACTGCTAAGACTGGATATGAA (forward) ECAQp (probe) VIC-CCCGCAAGGGTATGCTGAGAGATGG ECAQr (reverse) TTACCAACTAACTAATGTGCCGCA C. pruni 18S rDNA CPf (forward) CAAGTACGTCCCCGTTGATCA CPp (probe) FAM-TTAGAGGTTCGAAGGCGATCAGATACCGC CPr (reverse) GCTGGCTGACATCGTTTATGG Table 2. Guidelines to the choice of the primer set depending on the purpose (i.e., identification or quantification). Source Conventional Semi-quantitative Quantitative PCR organism specific PCR specific PCR ‘Ca. P. prunorum’ Internal control Insect ESFYf/r ESFYf/r ECAQf/p/r CP f/p/r Plant ESFYf/r ESFYf/r (see Christensen et al., 2004) - 57 -
Page 1 and 2:
Ecole Nationale Supérieure Agronom
Page 3 and 4:
Glossaire A leur première occurren
Page 5 and 6: C. Conclusions sur l’étude des v
Page 7 and 8: Introduction - 7 - « Deux grands m
Page 9 and 10: l’intensification permanente de l
Page 11 and 12: Ceci nous amène aux enjeux liés
Page 13 and 14: (b) Coût de la lutte contre l’ES
Page 15 and 16: Royaume- Uni Espagne Allemagne Belg
Page 17 and 18: 1992) ; par contre, le cerisier dou
Page 19 and 20: 6) Vection Le vecteur de l’ESFY (
Page 21 and 22: (b) Caractéristiques de la vection
Page 23 and 24: Conifères ? Rétention du phytopla
Page 25 and 26: Partie I : Identifier des facteurs
Page 27 and 28: Identifying Risk Factors from a Sur
Page 29 and 30: MATERIALS AND METHODS Data Record a
Page 31 and 32: visual inspection of their spatial
Page 33 and 34: Influence of the Risk Factors. The
Page 35 and 36: Model Application This kind of mode
Page 37 and 38: ACKNOWLEDGEMENTS We are much indebt
Page 39 and 40: 42. Seemüller, E., and Schneider,
Page 41 and 42: TABLE 5: Analysis of deviance for e
Page 43 and 44: Fig. 2. Examination of the model fi
Page 45 and 46: II. Bilan Au-delà des effets évid
Page 47 and 48: Partie II : Identifier les cycles b
Page 49 and 50: A toolbox for the specific detectio
Page 51 and 52: Bordeaux). Plant samples were also
Page 53 and 54: cycles). The analyses were performe
Page 55: The above semi-quantification relie
Page 59 and 60: ESFY G1R (X) ESFY G2 (X) AP15R (X)
Page 61 and 62: Survival of European Stone Fruit Ye
Page 63 and 64: C. pruni Reimmigrants The percentag
Page 65 and 66: Table 1. Detection of ESFY from C.
Page 67 and 68: Si l’expérience est répétée d
Page 69 and 70: Il y a cependant deux réserves à
Page 71 and 72: The spread of European stone fruit
Page 73 and 74: inside the cage. The cages were rem
Page 75 and 76: Quantification of ‘Ca. P. prunoru
Page 77 and 78: prunorum’: the infectious reimmig
Page 79 and 80: Table 2. Occurrence of Cacopsylla p
Page 81 and 82: Number of C. pruni on P. spinos 40
Page 83 and 84: V. Bilan sur le fonctionnement de l
Page 85 and 86: Partie III : Tester des hypothèses
Page 87 and 88: émergents migrent dans des massifs
Page 89 and 90: identique à Qc(d) sauf qu’elle e
Page 91 and 92: MATERIALS AND METHODS Characteristi
Page 93 and 94: allows summarising in one graph (i)
Page 95 and 96: (A) (B) Fig. 1. Summary of the spat
Page 97 and 98: Investigating Disease Spread betwee
Page 99 and 100: when some plants may be missing for
Page 101 and 102: the graphical display by an appropr
Page 103 and 104: shows that the proportion of missin
Page 105 and 106: the approach developed by Pélissie
Page 107 and 108:
APPENDIX Test 2. This section corre
Page 109 and 110:
several types of points. J. R. Stat
Page 111 and 112:
TABLE 4. Type I error and power of
Page 113 and 114:
Fig. 2. Spatiotemporal pattern of d
Page 115 and 116:
IV. Application à l’analyse de c
Page 117 and 118:
Verger D1-4 Verger BH1 Verger BH2 V
Page 119 and 120:
annuelle (Figure 1 de l’Article V
Page 121 and 122:
consiste à disposer de vergers à
Page 123 and 124:
Partie IV : Synthétiser l’inform
Page 125 and 126:
Tableau 6. Propriétés biologiques
Page 127 and 128:
Conclusion - 127 - « Il importe de
Page 129 and 130:
fonctionnement du système épidém
Page 131 and 132:
Tableau 7. Avantages et inconvénie
Page 133 and 134:
malades correspondrait alors unique
Page 135 and 136:
Expérimentations expérimentales S
Page 137 and 138:
Références bibliographiques - 137
Page 139 and 140:
30. Chabrolin C. (1924) Quelques ma
Page 141 and 142:
86. Institute of Medicine (1992) Em
Page 143 and 144:
138. Morvan G. (1977) Apricot chlor
Page 145 and 146:
190. Torres E., Martin M. P., Paltr
Page 147 and 148:
Annexes - 147 -
Page 149 and 150:
if (estim!=1) W2.99) text(B2,0,past
Page 151 and 152:
if ((sum(Do[1:4])!=0)&(sum(do1D)==0
Page 153 and 154:
III. Annexe 3 : Programme R pour si
Page 155 and 156:
IV. Annexe 4 : “Testing Boolean A
Page 157 and 158:
Testing boolean assumption in the n
Page 159 and 160:
ehavior, which is difficult to obse
Page 161 and 162:
distributed. So, the length distrib
Page 163 and 164:
ule which transforms the tangent po
Page 165 and 166:
large void segments will clearly ap
Page 167 and 168:
together with local measurements at
Page 169 and 170:
Kamphorst E.C. , Chadøeuf J. , Jet
Page 171 and 172:
c.d.f 0.0 0.2 0.4 0.6 0.8 1.0 0 1 2
Page 173 and 174:
0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4
Page 175 and 176:
c.d.f. c.d.f. c.d.f. 0.0 0.2 0.4 0.
Page 177:
RESUME Les maladies (ré-)émergent
show all

Ecole Nationale Supérieure Agronomique de Montpellier ... - CIAM

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?