Ecole Nationale Supérieure Agronomique de Montpellier ... - CIAM

More documents

Recommendations

Info

A B Fig. 1. Specificity (A) and sensitivity (B) validation to ESFYf/r primers by conventional PCR. Agarose gel (1.5%) showing amplification products obtained by universal primer fU5/rU3. (A) phytoplasmas: (1) ‘Ca. P. prunorum’ laboratory; (2) ‘Ca. P. prunorum’ field isolate; (3) ‘Ca. P. asteris’ (European aster yellows); (4) Peach Western X; (5-6) ‘Ca. P. mali’ (apple proliferation, strains AP and AT, respectively); (7) ‘Ca. P. phoenicium’; (8) ‘Ca. P. pyri’ (pear decline); (9) Stolbur; (10) Healthy sample (Catharantus roseus); M, 100 pb DNA marker. (B) Dilution series of ‘Ca. P. prunorum’ laboratory isolate: (1) 10 -1 ; (2) 5 10 -2 ; (3) 10 -2 ; (4) 5 10 -3 ; (5) 10 -3 ; (6) 510 -4 ; (7) 10 -4 ; (8) 5 10 -5 ; (9) 10 -5 ; (10) 510 -6 ; (11) 10 -6 ; (12) Healthy sample (C. roseus); (13) PCR mix. All the isolates were kindly provided by X. Foissac (INRA, Bordeaux) except ‘Ca. P. prunorum’ field isolate. A 1500 bp- 600 bp- 100 bp- M 1 2 3 4 5 6 7 8 9 10 M M 1 2 3 4 5 6 7 8 9 10 11 12 13 M Fig. 2. phytoplasma specificity of ECAQf/r (A) and Psyllid specificity of CPf/r (B). (A) Agarose gel (2%): M: size marker; (1) ‘Ca. P. prunorum’ laboratory; (2) ‘Ca. P. prunorum’ orchard isolate; (3) ‘Ca. P. asteris’ (Aster Yellow European); (4) Peach Western X; (5-6) ‘Ca. P. mali’ (apple proliferation, strains AP and AT, respectively); (7) ‘Ca. P. phoenicium’; (8) ‘Ca. P. pyri’ (Pear Decline); (9) Stolbur; (10) Healthy plant sample (Catharantus roseus); (11) Infected psyllid; (12) Healthy psyllid; (13) PCR mix. (B) Agarose gel (2%): M, size marker; (1) Cacopsylla pruni (near Perpignan); (2) C. pruni (near Montpellier); (3) Psyllid sp. (4) Aphid (Myzus persicae); (5) Escherichia coli; (6) Operator contamination; (7) PCR mix. - 58 - M 1 2 3 4 5 6 7 8 9 10 11 12 13 M 1500 bp- 600 bp- 100 bp- B M 1 2 3 4 5 6 7 M
ESFY G1R (X) ESFY G2 (X) AP15R (X) PD1R A (X) SpaWB (X) BWB (X) OY-M (I) AlmWB (IX) WX (III) CCATCATTTAGT--TGGGCACT 464 bp CAA------TAATGG-CTTGGGCCTAT ............--........ 464 bp ...------......-........... ............--........ 463 bp A..------......T.CG........ ............--........ 465 bp T..------......-.CG........ ............--........ 463 bp AT.------.T.C..TT.G........ ...G....C...--....G... 459 bp .T.------.G.------A........ ...G..CG..A.GG....G... 485 bp TT.ATCTTT.T.A.ATTAA........ .G.C..CA..A.GG..A..... 468 bp TTT-------TGATAT.C......... ...G...G..A.GA....G... 467 bp TT.-------.GGCATTAA........ B ECAQf ECAQp ECAQr ESFY G1 R (X) ESFY G2 (X) AP15 R (X) PD1 R (X) SpaWB (X) BWB (X) OY-M (I) AlmWB (IX) WX (III) ESFYf ESFYr AAACGACTGCTAAGACTGGATATGAA 30 bp CCCGC----AAGGGTATGCTGAGAGATGGGCTTGCGGCACATTAGTTAGTTGGTAA .......................... .....----............................................... ......................G... .....----...........A................................... ......................G... .....----............................................... ......................G... ..T.A----...................A........................... ......T...............G... ..T..----..A..........A........................T........ ......................G..G ..TAG--CA.TA........T..G..G.A.......T.................GG ....AGT...............G... ..TTTTTCGG.A........T.A...G.........C................... ....AGT...............G... T.TT.TTT-G.A........T.AG..G.........A..................G Fig. 3. Sequence alignment of the 16S-IS-23S rDNA region showing the specificity of the designed primers and probes in relation to other phytoplasmas belonging to the 16SrX group or occurring in stone fruit trees. The 16S rDNA groups are indicated in parenthesis. (A) ESFYf/r primers for the specific detection and semi-quantification of ‘Ca. P. prunorum’ in plants or insects. (B) ECAQf/p/r primers and probe for the quantification of ‘Ca. P. prunorum’ in insects. Fig. 4. Real-time simplex PCR standard curves on ‘Ca. P. prunorum’ DNA reference sample dilution. - 59 -
Page 1 and 2:
Ecole Nationale Supérieure Agronom
Page 3 and 4:
Glossaire A leur première occurren
Page 5 and 6:
C. Conclusions sur l’étude des v
Page 7 and 8: Introduction - 7 - « Deux grands m
Page 9 and 10: l’intensification permanente de l
Page 11 and 12: Ceci nous amène aux enjeux liés
Page 13 and 14: (b) Coût de la lutte contre l’ES
Page 15 and 16: Royaume- Uni Espagne Allemagne Belg
Page 17 and 18: 1992) ; par contre, le cerisier dou
Page 19 and 20: 6) Vection Le vecteur de l’ESFY (
Page 21 and 22: (b) Caractéristiques de la vection
Page 23 and 24: Conifères ? Rétention du phytopla
Page 25 and 26: Partie I : Identifier des facteurs
Page 27 and 28: Identifying Risk Factors from a Sur
Page 29 and 30: MATERIALS AND METHODS Data Record a
Page 31 and 32: visual inspection of their spatial
Page 33 and 34: Influence of the Risk Factors. The
Page 35 and 36: Model Application This kind of mode
Page 37 and 38: ACKNOWLEDGEMENTS We are much indebt
Page 39 and 40: 42. Seemüller, E., and Schneider,
Page 41 and 42: TABLE 5: Analysis of deviance for e
Page 43 and 44: Fig. 2. Examination of the model fi
Page 45 and 46: II. Bilan Au-delà des effets évid
Page 47 and 48: Partie II : Identifier les cycles b
Page 49 and 50: A toolbox for the specific detectio
Page 51 and 52: Bordeaux). Plant samples were also
Page 53 and 54: cycles). The analyses were performe
Page 55 and 56: The above semi-quantification relie
Page 57: Table 1. Sequence of the primers an
Page 61 and 62: Survival of European Stone Fruit Ye
Page 63 and 64: C. pruni Reimmigrants The percentag
Page 65 and 66: Table 1. Detection of ESFY from C.
Page 67 and 68: Si l’expérience est répétée d
Page 69 and 70: Il y a cependant deux réserves à
Page 71 and 72: The spread of European stone fruit
Page 73 and 74: inside the cage. The cages were rem
Page 75 and 76: Quantification of ‘Ca. P. prunoru
Page 77 and 78: prunorum’: the infectious reimmig
Page 79 and 80: Table 2. Occurrence of Cacopsylla p
Page 81 and 82: Number of C. pruni on P. spinos 40
Page 83 and 84: V. Bilan sur le fonctionnement de l
Page 85 and 86: Partie III : Tester des hypothèses
Page 87 and 88: émergents migrent dans des massifs
Page 89 and 90: identique à Qc(d) sauf qu’elle e
Page 91 and 92: MATERIALS AND METHODS Characteristi
Page 93 and 94: allows summarising in one graph (i)
Page 95 and 96: (A) (B) Fig. 1. Summary of the spat
Page 97 and 98: Investigating Disease Spread betwee
Page 99 and 100: when some plants may be missing for
Page 101 and 102: the graphical display by an appropr
Page 103 and 104: shows that the proportion of missin
Page 105 and 106: the approach developed by Pélissie
Page 107 and 108: APPENDIX Test 2. This section corre
Page 109 and 110:
several types of points. J. R. Stat
Page 111 and 112:
TABLE 4. Type I error and power of
Page 113 and 114:
Fig. 2. Spatiotemporal pattern of d
Page 115 and 116:
IV. Application à l’analyse de c
Page 117 and 118:
Verger D1-4 Verger BH1 Verger BH2 V
Page 119 and 120:
annuelle (Figure 1 de l’Article V
Page 121 and 122:
consiste à disposer de vergers à
Page 123 and 124:
Partie IV : Synthétiser l’inform
Page 125 and 126:
Tableau 6. Propriétés biologiques
Page 127 and 128:
Conclusion - 127 - « Il importe de
Page 129 and 130:
fonctionnement du système épidém
Page 131 and 132:
Tableau 7. Avantages et inconvénie
Page 133 and 134:
malades correspondrait alors unique
Page 135 and 136:
Expérimentations expérimentales S
Page 137 and 138:
Références bibliographiques - 137
Page 139 and 140:
30. Chabrolin C. (1924) Quelques ma
Page 141 and 142:
86. Institute of Medicine (1992) Em
Page 143 and 144:
138. Morvan G. (1977) Apricot chlor
Page 145 and 146:
190. Torres E., Martin M. P., Paltr
Page 147 and 148:
Annexes - 147 -
Page 149 and 150:
if (estim!=1) W2.99) text(B2,0,past
Page 151 and 152:
if ((sum(Do[1:4])!=0)&(sum(do1D)==0
Page 153 and 154:
III. Annexe 3 : Programme R pour si
Page 155 and 156:
IV. Annexe 4 : “Testing Boolean A
Page 157 and 158:
Testing boolean assumption in the n
Page 159 and 160:
ehavior, which is difficult to obse
Page 161 and 162:
distributed. So, the length distrib
Page 163 and 164:
ule which transforms the tangent po
Page 165 and 166:
large void segments will clearly ap
Page 167 and 168:
together with local measurements at
Page 169 and 170:
Kamphorst E.C. , Chadøeuf J. , Jet
Page 171 and 172:
c.d.f 0.0 0.2 0.4 0.6 0.8 1.0 0 1 2
Page 173 and 174:
0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4
Page 175 and 176:
c.d.f. c.d.f. c.d.f. 0.0 0.2 0.4 0.
Page 177:
RESUME Les maladies (ré-)émergent
show all

Ecole Nationale Supérieure Agronomique de Montpellier ... - CIAM

Create successful ePaper yourself

Delete template?

Save as template?