Detection and Expression of Biosynthetic Genes in Actinobacteria ...

More documents

Recommendations

Info

BERVANAKIS, G.Chapter 3: RESULTSgenes that constitute the minimal PKS required to create the carbon skeleton of thepolyketide molecule (McDaniel et al., 1994). The PCR primers were designedaccording to the consensus sequences of 29 amino acid and 26 nucleic acidsequences derived from multiple sequence alignments of actinobacterial KS α genesavailable in the GenBank/EMBL databases at that time (Figures 20 and 21). Fromthese 26 KS α nucleic acid sequences 24 were from Streptomyces spp, and two fromnon-streptomyces species these were from a Actinomadura spp. and from aKibdelosporangium spp. The primers designed were used to amplify a 0.47 kbproduct corresponding to an internal fragment from within the KS α gene (Figure 19).The design strategy employed embedding a 19 base pair forward primer (act04f) inthe active site of the KS α gene at nucleic acid position 595-614 (numbers correspondto Streptomyces coelicolor GenBank accession number: X63449), the corresponding21 base pair reverse primer (act06r) was positioned at 1048-1069 flanking the KS αgene (Figures 20 and 21).Minimal Polyketide Synthase Gene Organizationβ-ketoacyl synthase KS α (1272 bp) β-ketoacyl synthase KS β (1227 bp)KSATKS AT ACPact04fact06rPCR product = 0.47 kbKS = ketosynthase AT = acyltransferase ACP = acyl carrier proteinFigure 19. Illustration depicting the conserved minimal PKS gene organization inType II PKS. Design strategy used to obtain a internal fragment within the KS α genefrom uncharacterised environmental actinobacterial isolates.Evaluation of the amino acid alignment of the act04f primer sequence, indicated thatthe 5’ region is variable (Figure 20 & Table 33). The act04f primer has the sequenceMVSTGC, in the amino acid sequence alignment with other actinobacteria it isevident that two degenerate codons occur at positions 1 and 4. Codon 4 is the criticalcodon at the 3’ end however three possible amino acids occur at that position acrossdifferent actinobacterial species these include Aspartic Acid (GAT/C), Alanine(GCA/T/C/G) and Tyrosine (TAT/C). In this case a degenerate primer covering allthese possible combinations would have been more appropriate. Partial nucleotide___________________________________________________________________________________71
BERVANAKIS, G.Chapter 3: RESULTSsequence homology can be a problem particularly at the 3’end of the primer which isused for initial recognition of annealing and if the first seven bases at the 5’ terminusare not conserved then efficient binding does not occur and either non-specificproducts are produced as seen in figure 22 (lanes 6,11 & 12) or the primer does notrecognise the template and there are no amplification products. Evaluation of thereverse primer (act06r) sequence alignments indicated that across differentactinobacteria a highly conserved sequence QND(X)HET (Figure 20 & Tables 33)which can be used to construct a universal primer for actinobacteria.Table 33. Relative amino acid positions and codon degenerecies of act04f and act06rprimers within the sequence.Primer AminoAcidActualPrimerStreptomycesAmino AcidAmino AcidSequence~Amino AcidSequence*Position Amino AcidSequenceSequence aact04f 170 - 175 MVSTGC VVSTGC (X)VS(X)GC (X)(X)STGCact06r 323 - 329 QNDRHET QNDRHET QND(X)HET QNDRHET(X) = variable codona Streptomyces consesus sequence for targeted regions~ Streptomycete and Non-Streptomycete Actinobacteria species* Non - Streptomycete Actinobacteria species onlyTable 34. Relative nucleic acid positions of act04f and act06r primers and variablenucleotides within the sequencePrimer NucleicAcidNucleic AcidSequence~Nucleic AcidSequence*Positionact04f 595 – 614 NNNNNTNTCNNCNGGNTGC GNTGNTCTCCACCGGCTGCact06r 1048 - 1069 GCAGAACGACNNNCACGAGAC GCAGAACGACCGGCACGAGAC(N) = variable base~ Streptomycete and Non-Streptomycete Actinobacterial species* Non- Streptomyces species onlyValidation of the specificity of the act04f and act06r primers was performed by directsequencing of the amplified 0.47 kb product from the actinobacterial type strainStreptomyces nogalater (ATCC27451), known to contain the KS α gene (Torkkell etal., 2001). Confirmation that the correct sequence had been amplified was verifiedusing a gapped-FASTA search that the nucleotide and the translated amino acidsequence were similar to known Type II PKS sequences from actinobacterial species.___________________________________________________________________________________72
Page 1 and 2:
___________________________________
Page 3 and 4:
___________________________________
Page 5 and 6:
___________________________________
Page 7 and 8:
___________________________________
Page 9 and 10:
___________________________________
Page 11 and 12:
___________________________________
Page 13 and 14:
___________________________________
Page 15 and 16:
___________________________________
Page 17 and 18:
___________________________________
Page 19 and 20:
BERVANAKIS, G.Chapter 1: INTRODUCTI
Page 21 and 22:
Page 23 and 24:
Page 25 and 26:
Page 27 and 28:
Page 29 and 30:
Page 31 and 32:
Page 33 and 34:
Page 35 and 36:
Page 37 and 38:
Page 39 and 40:
Page 41 and 42: BERVANAKIS, G.Chapter 1: INTRODUCTI
Page 71 and 72: BERVANAKIS, G.Chapter 2: MATERIALS
Page 91: BERVANAKIS, G.Chapter 3: RESULTSSec
Page 95 and 96: BERVANAKIS, G.Chapter 3: RESULTSFig
Page 97 and 98: BERVANAKIS, G._____________________
Page 99 and 100: BERVANAKIS, G.Chapter 3: RESULTSwit
Page 101 and 102: BERVANAKIS, G.Chapter 3: RESULTSTab
Page 103 and 104: BERVANAKIS, G.Chapter 3: RESULTS3.1
Page 105 and 106: BERVANAKIS, G.Chapter 3: RESULTSof
Page 107 and 108: BERVANAKIS, G. Chapter 3: RESULTS18
Page 111 and 112: BERVANAKIS, G.Chapter 3: RESULTSDes
Page 119 and 120: BERVANAKIS, G.Chapter 3: RESULTSOf
Page 125 and 126: BERVANAKIS, G.Chapter 3: RESULTSLan
Page 129 and 130: BERVANAKIS, G.Chapter 3: RESULTSThe
Page 133 and 134: BERVANAKIS, G.Chapter 4: DISCUSSION
Page 143 and 144:
BERVANAKIS, G.Chapter 4: DISCUSSION
Page 145 and 146:
Page 147 and 148:
Page 149 and 150:
Page 151 and 152:
Page 153 and 154:
Page 155 and 156:
Page 157 and 158:
___________________________________
Page 159 and 160:
___________________________________
Page 161 and 162:
___________________________________
Page 163 and 164:
___________________________________
Page 165 and 166:
___________________________________
Page 167 and 168:
___________________________________
Page 169 and 170:
___________________________________
Page 171 and 172:
___________________________________
Page 173 and 174:
___________________________________
Page 175 and 176:
___________________________________
Page 177 and 178:
___________________________________
Page 179 and 180:
___________________________________
Page 181 and 182:
___________________________________
Page 183 and 184:
___________________________________
Page 185 and 186:
___________________________________
Page 187 and 188:
___________________________________
Page 189 and 190:
___________________________________
Page 191 and 192:
___________________________________
Page 193 and 194:
___________________________________
Page 195 and 196:
___________________________________
Page 197 and 198:
___________________________________
Page 199 and 200:
___________________________________
Page 201 and 202:
___________________________________
Page 203 and 204:
___________________________________
Page 205 and 206:
___________________________________
Page 207 and 208:
___________________________________
Page 209:
BERVANAKIS, G. APPENDIX 1Appendix 1
show all

Detection and Expression of Biosynthetic Genes in Actinobacteria ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?