sdu faculty of forestry journal special edition 2009 - Orman Fakültesi

SDÜ Faculty of Forestry Journal
inspecting the asci for the presence of filiform ascospores, which initiate infections.
Another objective of this research was to confirm the genetic identity of the
organism causing tar spot on a range of maples in Ontario. And the final objective
was to look at fungicidal control of tar spot.
2. METHODS
2.1 Sporulation
After snowmelt, overwintered leaves of Norway maple bearing tar spots caused
by Rhytisma acerinum were collected from a copse of maples at the Guelph
Turfgrass Institute, Guelph, Ontario every week from March through August in
2007 and 2008. Diseased Norway maple leaves were soaked in distilled water for
24 h to allow the apothecia to open, and many spots were examined, with several
cross-sections per spot. The percent asci that were empty was estimated. Maple
phenology and weather conditions were also recorded at each sampling.
2.2 Genetic Identity
Samples of tar spot from a variety of different maple species were collected
from Ontario and Quebec, Canada in 2007 and 2008. We used the Qiagen
DNAeasy kit (Qiagen Inc., Mississauga, Ontario, Canada), to extract DNA from
these samples. This DNA was then amplified with conserved ITS primers which
target the internal transcribed spacer region of ribosomal DNA spanning the 3' end
of the 18S gene to the 5' end of the 28S gene. The primer pair, ITS1
(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC)
were from White et al. (1991). The 12 5 ul reaction mixture for PCR amplification
contained the following : 10 ng DNA, 1 DNA polymerase buffer, 0 5 ìm of each
primer, and 1 U Tsg DNA polymerase (Biobasic, Scarborough, Ontario, Canada).
Amplifications were performed in a GeneAmp PCR System 2400 (Perkin Elmer,
Norwalk, CT, USA), with an initial denaturation step of 94 for 2 min, followed by
35 cycles of 94 for 30 s, 55 for 1 min, and 72 for 2 min, and a final extension at 72
for 7 min. These PCR reactions were sent for sequencing at the Laboratory
Services Division, University of Guelph with both forward and reverse primers. At
least two tar spot sequences from each maple species were used for analyses.
2.3 Fungicidal Control
The fungicide trials were conducted at the Guelph Turfgrass Institute, Guelph,
Ontario, Canada on 2 m tall plants. These plants had been obtained from a local
nursery as bareroot saplings over 2 m tall, and were planted in the local Fox Sandy
Loam soil in early May 2007. The trees were placed in four rows adjacent to a
older stand of Norway maple trees. There was 1.5 m between the rows and 1.2 m
between the trees. Each row was considered a block and consisted of 10 trees.
Treatments were applied to each tree at two-week intervals but to different
branches or twigs on each of five dates in 2008: May 6, May 20, June 4, June 17,
190