GTMB 7 - Gene Therapy & Molecular Biology

More documents

Recommendations

Info

Buldak and Mirkin: Hypersensitivity of the d(GA) n •d(TC) n dependent on lactose repressorincreased, usually by growing cells in the presence ofchloramphenicol, and (ii) ambient conditions of cellgrowth favored H-DNA formation by either the presenceof divalent cations or decreased pH of the media.Another group of studies focused on ad(GA) n •d(TC) n repeat found within the promoter region ofthe hsp26 gene in Drosophila. Both the GA repeat and aprotein factor that recognizes it, GAGA-factor, arerequired for the proper functioning during the heat-shockresponse in Drosophila. While this repeat forms H-DNA invitro, in vivo studies, using mutational analysis andchemical footprinting, indicate that protein binding to thisrepeat rather than its triplex-forming potential, is essentialfor the promoter function (Glaser et al, 1990; Lu et al,2003).One can conclude, therefore, that the formation of H-DNA by a d(GA) n •d(TC) n repeat can be induced in E. colicells in principle, but is not readily detectable in a naturalsetting, such as the Drosophila genome. We decided,therefore, to look at the structure of the d(GA) n •d(TC) nrepeats cloned into an E. coli plasmid under physiologicalgrowth conditions. In this setting, one can elevate negativeDNA supercoiling in the upstream promoter region byinducing transcription (Liu and Wang, 1987; Wu et al,1988). We have previously demonstrated that transcriptiondoes, in fact, elevate DNA supercoiling in vivo inducingcruciform formation at d(AT) n •d(TA) n repeats as far as 1kbp upstream of the promoter (Dayn et al, 1992;Krasilnikov et al, 1999).We inserted the d(GA) n •d(TC) n repeat in twopossible orientations upstream of an inducible promoterand probed its structure by chemical modification withchloroacetaldehyde (CAA) in vivo. While we observedchemical hyperreactivity within the repeat, its pattern wasinconsistent with H-DNA or other known structures.Furthermore, this chemical reactivity was repressed, ratherthan enhanced, upon induction of transcription. Finally,hyper-modification of the d(GA) n •d(TC) n repeat requiredfunctional lactose repressor. We believe, therefore, thatlactose repressor could contribute to a structural alterationwithin the d(GA) n •d(TC) n repeat, leading to its chemicalhyper-reactivity in vivo.II. Materials and methodsA. PrimersSequencing primers used were: Sequencing primer Pr1(5'ACGGTGCACCAATGCTTCTG3') and Pr2(5'CCGGCTCGTATAATGTGT3'). Primers for PCR-mediateddeletion of lactose operators were as follows: del1(5'AAAAAGCTTCACTGCCCGCTTTC3');del1'(5'GCCGTCAACCACCATC3');del2(5'AAAAAGCTTAGCGCGAATTGATC3');del2'(5'CGGATAAAACTTGTGC3');del3(5'AAAACTCGAGTTCCACACATTATAC3');del3'(5'AAAACTCGAGTCACACAGGAAACAGAC3'); del4(5'TAGGTACATTGAGCAAC3');del5(5'TGTGACTCGAGTATTCGCTTGCTTATACGAGCCGGATG3').B. Plasmid constructionPlasmid pTrc99A (Amann et al, 1988) was obtained fromPharmacia. Plasmid pTrcCat/Pst, carrying the unique PstI site atthe -50 position relative to the trc promoter, was described in(Krasilnikov et al, 1999). Plasmid pTrcCat/Cla, carrying theunique ClaI site at the -180 position relative to the trc promoter,was a gift from Dr. Andrey Krasilnikov. Inserts containingd(GA) 30 •d(TC) 30 and d(GA) 37 •d(TC) 37 repeats were obtained bythe EcoRI/HindIII digestion of the pGA30 and pGA37 plasmids,respectively, described in (Krasilnikova et al, 2001). Theserepeats were cloned into either the PstI site of pTrcCat/Pstplasmid, or the ClaI of the pTrcCat/Cla plasmid.C. Operator deletionsThe primary operator site, lacO1, was deleted by using thefollowing PCR-based approach. Plasmid pTrcCat/Pst-GA37 wasused as a template for independent PCR reactions with two pairsof primers. Using primers del1' and del3, a fragment of theplasmid was amplified that included the repeat, and the regionimmediately upstream of the O1 site relative to the transcriptionstart site. A second fragment was generated using primers del3'and del4 that included the region immediately downstream of theO1 site. The two fragments were designed such that an XhoIrestriction site replaced the O1 operator upon XhoI-digestion andco-ligation.Pseudo-operator O3 was deleted by a similar approachusing two PCR fragments from the pTrcCat/Pst-GA37 template.One of the fragments was amplified with primers del1 and del1',corresponding to the region immediately upstream of the O3 site.The other fragment was produced with primers del2 and del4,and contained the region immediately downstream of the O3 site.These fragments were generated such that a HindIII restrictionsite substituted for the O3 operator upon HindIII digestion andco-ligation.To construct the plasmid without both operator sites, ΔO1-ΔO3, we deleted the O3 operator from the ΔO1 plasmid using thePCR approach described above.In all these cases, the ligated PCR products contained NarIand KpnI sites at their 5'- and 3'-ends, respectively. Upondigestion with these two restriction enzymes, they were used toreplace the corresponding NarI-KpnI fragment of the originalpTrcCat/Pst plasmid.D. Repressor deletionDeletion of the lacI q gene was achieved by excising the 0.9kbp BssHII fragment, containing the coding part of the repressor,from the pTrcCat/Pst-GA 37 plasmid.E. Bacterial strainsWe used either an XL1-Blue strain (Invitrogen) or itsderivative XL1-BluES, which was cured of the F'-factor by uspreviously (Krasilnikova et al, 2001).F. Chemical probing of intracellular DNAIntracellular plasmid DNA was modified withchloroacetaldehyde as described in (Krasilnikov et al, 1999).G. Radiolabeling of DNA fragments andMaxam-Gilbert sequencing reactionsLabeling and sequencing reactions were carried outaccording to standard protocols (Sambrook et al, 1989).292
Gene Therapy and Molecular Biology Vol 7, page 293III. ResultsTo look at the structure of d(GA) n •d(TC) n repeatsunder the influence of superhelical stress induced bytranscription, we placed this repeat upstream of theinducible trc promoter in the multicopy pTrc-derivedplasmid. DNA footprinting was carried out by CAA invivo under conditions of both promoter induction andrepression. CAA interacts specifically with base pairingpositions of cytosines and adenines. Consequently, thestability of phosphodiester bonds decreases, and, afterMaxam-Gilbert DNA sequencing, one can see additionalbands corresponding to modified cytosines on the purineladder and to modified adenines on the cytosine ladder(Kohwi and Kohwi-Shigematsu, 1988). Since in doublestranded DNA, these positions are inaccessible, CAAmodification reveals single-standed DNA segments orother significant DNA distortions.The experimental results of chemical modification ofboth strands are presented in Figure 1. One can clearlyobserve modification within both the d(GA) n •d(TC) nrepeat and the trc promoter. The size of the repeat herewas 30 units and its subsequent increase to 37 units did notyield any difference in modification patterns. The schemeof modification within the d(GA) n •d(TC) n insert and thetrc promoter region is presented in Figure 2. As can beseen in the figure, adenine residues within the 3' third ofthe polypurine strand were modified above backgroundwhen the insert was placed into the plasmid in such a waythat the purines were on the top strand as drawn. In eachrepeat length, when IPTG was absent from the growingculture, the 13 3'adenine (A) residues were modified.When IPTG was added, the length of the modificationshrank. No modifications were observed within thepolypyrimidine strand.These results ran contrary to what was expected,based on the previous studies of different structure-pronerepeats. First, the modification was more profound in theabsence of transcription. Second, the modification wasonly evident on one DNA strand. Third, the modificationwas observed in only one orientation of the repeat relativeto the promoter. Furthermore, modification results areinconsistent with H-DNA formation by the d(GA) n •d(TC) nrepeat because of the lack of modification of thepolypyrimidine strand.As far as trc promoter structure, we observedprominent chemical hyperreactivity in both repressed andactivated state. When IPTG was absent, distinctmodifications could be observed at positions -8, -9, -11, -14, -16, -19, -20, -40, -43, -44, -45, -49 and -50 relative tothe transcription start site (TSS), designated +1.Modification patterns in all instances described changeddramatically upon addition of IPTG and promoteractivation. All hypermodifications present from -11 to -50disappeared. At the same time, new modifications thatwere not present in the absence of IPTG appeared atpositions +1 and +2. These results are also summarized inFigure 2.To confirm that these modifications within thepromoter were not occurring as a result of the presence ofa d(GA) n •d(TC) n insert, we performed the same type offootprint analysis on the empty vector, pTrcCat/Pst.Figure 1. CAA modification in vivo of the polypurine (left) andpolypyrimidine (right) strands of a d(GA) 37 •d(TC) 37 repeat in thepTrcCat/Pst plasmid. G, R and C represent Maxam-Gilbertsequencing reactions of plasmid DNA in vitro. IPTG - and +indicate CAA modifications in vivo in the absence or presence ofIPTG, respectively. IPTG 2' is a control in which the plasmidDNA was CAA-modified in vivo for two minutes, instead of thenormal 20 minutes. Arrows indicate modified adenine andcytosine bases.Chemical probing of this plasmid in the presence andabsence of IPTG revealed modification pattern of thepromoter region that was identical to that of repeatcontainingplasmids (Figure 3). Altogether, the promoterdata support the model in which RNA polymeraseinteracts with the DNA at positions from -10 to -50 whenthe promoter is in the repressed state. Upon induction,RNA polymerase moves forward such that RNApolymerase-DNA interaction is now readily seen aroundthe TSS instead of the 5'-part of the promoter.The promoter alone is modified up to position -50relative to the TSS. The d(GA) n •d(TC) n insert was insertedimmediately upstream of this point. It is conceivabletherefore, that modification of the repetitive run is causedby a mere extension of the promoter modification. Toaddress this possibility, repeats were moved back to aposition of -180 bp relative to the TSS. The unusualmodifications within the repeat remained when placed atthis position as well (Figure 4). Furthermore, theinhibitory effect of IPTG remained unchanged.293
Page 7 and 8:
Instructions to authors:Gene Therap
Page 9:
Please submit an electronic version
Page 12:
103-111 ResearchArticle113-133 Revi
Page 17 and 18:
Gene Therapy and Molecular Biology
Page 19 and 20:
Page 21 and 22:
Page 23 and 24:
Page 25 and 26:
Page 27 and 28:
Page 29 and 30:
Page 31 and 32:
Page 33 and 34:
Page 35 and 36:
Page 37 and 38:
Page 39 and 40:
Page 41 and 42:
Page 43 and 44:
Page 45 and 46:
Page 47 and 48:
Page 49 and 50:
Page 51 and 52:
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64:
Page 65 and 66:
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
Page 77:
Page 80 and 81:
Epperly et al: Late injection of Mn
Page 82 and 83:
Epperly et al: Late injection of Mn
Page 84 and 85:
Goldberg-Cohen et al: Regulation of
Page 86 and 87:
Page 88 and 89:
Page 90 and 91:
Gascón-Irún et al: Gene therapy a
Page 92 and 93:
Page 94 and 95:
Page 96 and 97:
Page 98 and 99:
Page 100 and 101:
Page 102 and 103:
Page 104 and 105:
Page 106 and 107:
Suzuki et al: Regulation of the Sp/
Page 108 and 109:
Page 110 and 111:
Page 112 and 113:
Page 114 and 115:
Li et al: MET amplification in live
Page 116 and 117:
Li et al: MET amplification in live
Page 118 and 119:
Chavakis et al: Leukocyte adhesion
Page 120 and 121:
Page 122 and 123:
Page 124 and 125:
Page 126 and 127:
Page 128 and 129:
Sanlioglu et al: Adenovirus mediate
Page 130 and 131:
Page 132 and 133:
Page 134 and 135:
Page 136 and 137:
Page 138 and 139:
Page 140 and 141:
Page 142 and 143:
Page 144 and 145:
Page 146 and 147:
Page 148 and 149:
Page 150 and 151:
George et al: Gene therapy for vasc
Page 152 and 153:
Page 154 and 155:
Page 156 and 157:
Page 158 and 159:
Page 160 and 161:
Page 162 and 163:
Page 164 and 165:
Page 166 and 167:
Page 168 and 169:
Zhang et al: Angiogenic Gene Therap
Page 170 and 171:
Page 172 and 173:
Page 174 and 175:
Page 176 and 177:
Page 178 and 179:
Page 180 and 181:
Page 182 and 183:
Xu et al: G-CSF receptor-mediated S
Page 184 and 185:
Page 186 and 187:
Page 188 and 189:
Burek et al: Calcium induced cell d
Page 190 and 191:
Page 192 and 193:
Page 194 and 195:
Page 196 and 197:
David et al: Current status and fut
Page 198 and 199:
Page 200 and 201:
Page 202 and 203:
Page 204 and 205:
Page 206 and 207:
Page 208 and 209:
Page 210 and 211:
Page 212 and 213:
Page 214 and 215:
Page 216 and 217:
Page 218 and 219:
Page 220 and 221:
Page 222 and 223:
Page 224 and 225:
Page 226 and 227:
Stoll et al: The role of EBV and ge
Page 228 and 229:
Page 230 and 231:
Page 232 and 233:
Page 234 and 235:
Page 236 and 237:
Maruyama et al: Kidney-targeted pla
Page 238 and 239:
Page 240 and 241:
Page 242 and 243:
Page 244 and 245:
Kren et al: Hepatocyte-targeted del
Page 246 and 247:
Page 248 and 249:
Page 250 and 251:
Page 252 and 253:
Page 254 and 255:
Zeng: PRL-3 as a target for cancer
Page 256 and 257: Zeng: PRL-3 as a target for cancer
Page 258 and 259: Zeng: PRL-3 as a target for cancer
Page 260 and 261: Latchman: Protective effect of heat
Page 270 and 271: Cai et al: Lung cancer gene therapy
Page 280: Cai et al: Lung cancer gene therapy
Page 283 and 284: Gene Therapy and Molecular Biology
Page 305: Gene Therapy and Molecular Biology
Page 309: Gene Therapy and Molecular Biology
show all

GTMB 7 - Gene Therapy & Molecular Biology

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?