GTMB 7 - Gene Therapy & Molecular Biology

More documents

Recommendations

Info

Arora and Seth: Antigenicity and immunogenicity of HIV envelope genemedium, lactalbumin hydrolysate and yeast extract. Sf 21 cellswere cultured at 27 o C in TNM-FH medium supplemented with10% FBS (TNM-FH/FBS). Vaccinia expressed recombinantgp120 and gp160 (vPE8 and vPE16) were obtained through NIHAIDS Research and Reference Reagent Program.B. DNA constructs3kb env-tat-rev gene segment (nt 5352- nt 8354) of HIV-1subtype B strain, BRU, was PCR amplified using primers API(5352-5390) TTATTCTAGAGAGAAGAGCAAGAAATGGATCCAGTAGAT and APII (8316-8354)TTTTTGAGCTCTTGCCACCCATTTTAAAGTAAAGACCTTand cloned into pCR-Script (SK+) cloning vector to producepSBRU-TRE as described earlier (Arora and Seth, 2001). The3kb HIV-1 env-tat-rev gene segment was released by restrictiondigestion of pSBRU-TRE with Xba I, Not I and Bgl I. The env,tat and rev gene fragment was then purified from low meltingpoint agarose gel and subcloned into baculovirus transfer vector,pBacPAK9 predigested with Xba I and Not I to generatepBacBRU-TRE. Recombinant clone was screened by colonyhybridization followed by restriction enzyme analysis. pCIBRU-TRE, mammalian expression vector expressing 3kb HIV-1 envtat-revgene under the control of Immediate-EarlyPromoter/Enhancer of CMV, used in this study for immunizingBalb/c mice has been described earlier (Arora and Seth, 2001).C. Generating a recombinant virusRecombinant virus was prepared as per manufacturer'sinstructions. Briefly, 35mm tissue culture dishes were seededwith 1x10 6 Spodoptera frugiperda cells (Sf21) (Vaughn et al,1977) in 1.5 ml of complete TNM-FH/FBS medium andincubated overnight at 27 o C in a humid chamber. 500ng ofplasmid pBacBRU-TRE DNA, along with Bsu 361 digestedBacPAK6 viral DNA was mixed with 5µg of lipofectin andincubated at room temperature for 15 min. Culture medium in thetissue culture dishes containing Sf21 cells was replaced with 1.5ml of serum free TNM-FH. Lipofectin-DNA complex was thengently added to Sf21 cells. Plates were incubated at 27 o C for 5hrs. Thereafter, serum free TNM-FH medium was replaced withTNM-FH/FBS medium and the plates were returned forincubation at 27 o C for 4 days.D. Isolation of recombinant virusPlaque assay was performed using co-transfectionsupernatant to generate a pure clone of recombinant virus. 1x10 6Sf21 cells were seeded in 35mm tissue culture dishes andincubated overnight at 27 o C. These cells were then infected with100µl of neat or 10 -1 dilution of co-transfection supernatant. Onehour later, the virus inoculum was removed and infected cellswere overlaid with 1.5ml of agarose (1.5% in TNM-FH/FBS).After agarose was set 1.5 ml of TNM-FH/FBS medium wasadded to each dish and incubated for 4 days at 27 o C. Plaqueswere stained with .03% of neutral red solution. 4 plaques werepicked up and transferred into an eppendorf tube containing500µl of TNM-FH/FBS and stored at 4 o C overnight.E. Virus propagation and evaluationThe plaque picks were used as a source of virus to infectcells in a 96 well plate. Infections were performed in duplicate.Cells were harvested 4 days following infection and cell lysatewas used to perform dot blot analysis to detect the recombinantvirus. Each sample was suspended in 200µl of 0.5N NaOH and20µl of 10M-ammonium acetate. Samples were then spotted onto the nitrocellulose membrane by loading on the wells of the dotblot manifold apparatus (Bio Rad Laboratory, Richmond, CA).Vacuum suction was applied to drain off the entire solution.Membrane was dried at room temperature for 5-10 min and thenbaked for 2 hrs at 80 o C. Hybridization was performed usingα 32 P-dCTP labeled envelope probe prepared by random primerlabeling using Klenow fragment of DNA polymerase 1(Amersham Biosciences, Piscataway, NJ). The membrane wasthen washed and exposed to a Kodak-X film overnight at -70 o C.F. In vitro expressionA time course experiment was performed to examine theexpression of HIV-1 env gene in Sf 21 cells infected with therecombinant virus. Cells were harvested at various time intervalspost infection. SDS PAGE, immunofluorescence and WesternBlot analysis of cell lysate were conducted to study expression ofproteins. SDS-PAGE was performed according to Laemmli. ForWestern Blot analysis proteins were resolved by SDS-PAGE andtransferred onto a nitrocellulose membrane using Trans-blot SDsemi-dry electrophoretic transfer Cell (Bio Rad Laboratories)The membrane was treated with non-fat powdered milk in TTBS(Tween 20- Tris buffer Saline) for 1 hr at room temp. and reactedwith HIV-1 positive human polyclonal serum (at a dilution of1:200) in TBS for 1h at room temperature. After washing thricewith TTBS, the membrane was incubated at room temperaturefor 1 hr. with anti-human IgG conjugated with alkalinephosphatase (1:10,000). Membrane was then washed thrice withTTBS and incubated in the substrate solution (Sigma fastBCIP/NBT tablet dissolved in 10ml of deionized water, SigmaChemicals Co., St. Louis). For Immunofluorescence, P4(recombinant baculovirus) infected cells, uninfected cells(control) and AcNPv (wild type virus) infected cells wereharvested at different time points and washed thrice with PBS.1x10 4 cells were spotted onto the wells of a teflon-coated slideand fixed with acetone: methanol (1:1) at -20 o C for 30 min. Forstaining, cells were allowed to react with HIV-1 positive humanpolyclonal serum (1:50) for 1h at 37 o C. Cells were then washedwith PBS and incubated with FITC conjugated anti-human IgG(Sigma) and incubated for 1hr at 37 o C. Thereafter, the cells werewashed and mounted with glycerol buffer and visualized underfluorescent microscope.G. T cell proliferation assay3 H thymidine uptake assay was used to measure theproliferation of splenocytes after antigenic stimulation. Balb/cmice were immunized intramuscularly with pCIBRU-TRE orpCI (control vector) DNA as described earlier (Arora and Seth,2001). Six groups of Balb/c mice were taken (each groupcomprising 5 mice) (Table 1). In-group D3 three doses of 100 µgDNA each were given at bi-weekly intervals. In D0P2 groupanimals were immunized with 2 doses of P4 with no DNApriming. In-group D3P2 animals were immunized with 3 dosesof pCIBRU-TRE DNA followed by 2 doses of P4. Group D3V2consisted of mice immunized with 3 doses of pCIBRU-TREfollowed by 2 doses of recombinant vaccinia virus expressedgp120 and gp160 (vPE8 and vPE16). D0V2 group consisted ofmice immunized with 2 doses of vPE8 and vPE16 with nopriming with DNA construct and control group. Stimulatingantigens included vaccinia expressed recombinant gp160/gp120(vPE16/ vPE8) and baculovirus expressed gp160 (P4).Splenocytes from various groups of mice were harvested and resuspendedat a concentration of 2x10 6 cells/ml in RPMI 1640medium supplemented with 10% FCS. Cells were stimulated in38
Gene Therapy and Molecular Biology Vol 7, page 39triplicate. Five µg/ml of vPE16/vPE8 infected vero cell lysates/P4 infected Sf21 cell lysates was used in cell proliferation assay.Lysates of wild type vaccinia virus (WR) infected Vero cells/wild type baculovirus (AcNPv) infected Sf21 cell lysate wasused as control to study the non specific 3 H-thymidine uptakedue to wild type vaccinia/vero cell proteins or wild typebaculovirus/Sf21 cell protein in the cell lysates. Stimulationindex was calculated by the following formula.SI = Mean cpm of 3 H thymidine incorporated in the presence of stimulating antigen (vPE 16, vPES or P4)Mean cpm of 3 H thymidine incorporated in wild type virus (VacWR or AcNPv) controlII. ResultsA. Generating a Recombinant Baculovirus:Complete HIV-1 envelope glycoprotein along with theregulatory protein Tat and Rev were PCR amplified fromsubtype B, BRU strain of HIV-1 and cloned intopBacPAK9, baculovirus transfer vector, downstream tothe baculovirus polyhedrin gene promoter (Figure 1).Recombinant baculovirus transfer vector was screened bycolony hybridization followed by restriction enzymeanalysis and was termed as pBacBRU-TRE (Figure 2).Following co-transfection, recombinant baculovirus wasformed by the homologous recombination betweenpBacBRU-TRE and Bsu361 digested BacPAK6 viralDNA in the region flanking the chimeric gene, whichallows its insertion into the genome of the wild type virus.The BacPAK6 DNA is missing an essential portion of thebaculovirus genome, ORF1629, that is essential for viralreplication (Possee et al, 1991) When the DNArecombines with the vector (the transfer vector carries themissing ORF1629 sequence), the essential element isrestored and the target gene is transferred to thebaculovirus genome. Recombinant viruses were collectedand selected by plaque purification. Recombinantphenotype of the plaques is verified by Dot-Blot analysis.Two of the plaques were found to be positive by Dot-Blotanalysis and were termed as P4 and P5 (Figure 3). PlaqueP4 gave the stronger signal and was therefore amplifiedand used for further infections.Figure 1. a) pBacPAK9 baculovirus transfer vector, b)Recombinant plasmid pBacBRU-TRE. HIV-1 env, tat and revgene released on digestion of pSBRU-TRE was gel purified andsubcloned into baculovirus transfer vector pBacPAK9predigested with restriction enzymes Xba 1 and Not 1.Figure 2 a) Autoradiograph showing recombinant colonies asdetected by colony hybridization, b) Restriction enzyme analysisof the recombinant plasmid pBacBRU-TRE with differentenzymes. Lanes M: Lambda DNA digested with Hind IIIenzyme. Positions of the molecular weight markers are indicated,1: uncut; 2: pBacBRU-TRE digested with Bam H1; 3:pBacBRU-TRE digested with Hind III; 4: pBacBRU-TREdigested with Pvu II39
Page 7 and 8: Instructions to authors:Gene Therap
Page 9: Please submit an electronic version
Page 12: 103-111 ResearchArticle113-133 Revi
Page 17 and 18: Gene Therapy and Molecular Biology
Page 51: Gene Therapy and Molecular Biology
Page 77: Gene Therapy and Molecular Biology
Page 80 and 81: Epperly et al: Late injection of Mn
Page 82 and 83: Epperly et al: Late injection of Mn
Page 84 and 85: Goldberg-Cohen et al: Regulation of
Page 90 and 91: Gascón-Irún et al: Gene therapy a
Page 102 and 103:
Gascón-Irún et al: Gene therapy a
Page 104 and 105:
Gascón-Irún et al: Gene therapy a
Page 106 and 107:
Suzuki et al: Regulation of the Sp/
Page 108 and 109:
Page 110 and 111:
Page 112 and 113:
Page 114 and 115:
Li et al: MET amplification in live
Page 116 and 117:
Li et al: MET amplification in live
Page 118 and 119:
Chavakis et al: Leukocyte adhesion
Page 120 and 121:
Page 122 and 123:
Page 124 and 125:
Page 126 and 127:
Page 128 and 129:
Sanlioglu et al: Adenovirus mediate
Page 130 and 131:
Page 132 and 133:
Page 134 and 135:
Page 136 and 137:
Page 138 and 139:
Page 140 and 141:
Page 142 and 143:
Page 144 and 145:
Page 146 and 147:
Page 148 and 149:
Page 150 and 151:
George et al: Gene therapy for vasc
Page 152 and 153:
Page 154 and 155:
Page 156 and 157:
Page 158 and 159:
Page 160 and 161:
Page 162 and 163:
Page 164 and 165:
Page 166 and 167:
Page 168 and 169:
Zhang et al: Angiogenic Gene Therap
Page 170 and 171:
Page 172 and 173:
Page 174 and 175:
Page 176 and 177:
Page 178 and 179:
Page 180 and 181:
Page 182 and 183:
Xu et al: G-CSF receptor-mediated S
Page 184 and 185:
Page 186 and 187:
Page 188 and 189:
Burek et al: Calcium induced cell d
Page 190 and 191:
Page 192 and 193:
Page 194 and 195:
Page 196 and 197:
David et al: Current status and fut
Page 198 and 199:
Page 200 and 201:
Page 202 and 203:
Page 204 and 205:
Page 206 and 207:
Page 208 and 209:
Page 210 and 211:
Page 212 and 213:
Page 214 and 215:
Page 216 and 217:
Page 218 and 219:
Page 220 and 221:
Page 222 and 223:
Page 224 and 225:
Page 226 and 227:
Stoll et al: The role of EBV and ge
Page 228 and 229:
Page 230 and 231:
Page 232 and 233:
Page 234 and 235:
Page 236 and 237:
Maruyama et al: Kidney-targeted pla
Page 238 and 239:
Page 240 and 241:
Page 242 and 243:
Page 244 and 245:
Kren et al: Hepatocyte-targeted del
Page 246 and 247:
Page 248 and 249:
Page 250 and 251:
Page 252 and 253:
Page 254 and 255:
Zeng: PRL-3 as a target for cancer
Page 256 and 257:
Page 258 and 259:
Page 260 and 261:
Latchman: Protective effect of heat
Page 262 and 263:
Page 264 and 265:
Page 266 and 267:
Page 268 and 269:
Page 270 and 271:
Cai et al: Lung cancer gene therapy
Page 272 and 273:
Page 274 and 275:
Page 276 and 277:
Page 278 and 279:
Page 280:
Page 283 and 284:
Gene Therapy and Molecular Biology
Page 285 and 286:
Page 287 and 288:
Page 289 and 290:
Page 291 and 292:
Page 293 and 294:
Page 295 and 296:
Page 297 and 298:
Page 299 and 300:
Page 301 and 302:
Page 303 and 304:
Page 305 and 306:
Page 307 and 308:
Page 309:
show all

GTMB 7 - Gene Therapy & Molecular Biology

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?