GTMB 7 - Gene Therapy & Molecular Biology

Arora and Seth: Antigenicity and immunogenicity of HIV envelope genemedium, lactalbumin hydrolysate and yeast extract. Sf 21 cellswere cultured at 27 o C in TNM-FH medium supplemented with10% FBS (TNM-FH/FBS). Vaccinia expressed recombinantgp120 and gp160 (vPE8 and vPE16) were obtained through NIHAIDS Research and Reference Reagent Program.B. DNA constructs3kb env-tat-rev gene segment (nt 5352- nt 8354) of HIV-1subtype B strain, BRU, was PCR amplified using primers API(5352-5390) TTATTCTAGAGAGAAGAGCAAGAAATGGATCCAGTAGAT and APII (8316-8354)TTTTTGAGCTCTTGCCACCCATTTTAAAGTAAAGACCTTand cloned into pCR-Script (SK+) cloning vector to producepSBRU-TRE as described earlier (Arora and Seth, 2001). The3kb HIV-1 env-tat-rev gene segment was released by restrictiondigestion of pSBRU-TRE with Xba I, Not I and Bgl I. The env,tat and rev gene fragment was then purified from low meltingpoint agarose gel and subcloned into baculovirus transfer vector,pBacPAK9 predigested with Xba I and Not I to generatepBacBRU-TRE. Recombinant clone was screened by colonyhybridization followed by restriction enzyme analysis. pCIBRU-TRE, mammalian expression vector expressing 3kb HIV-1 envtat-revgene under the control of Immediate-EarlyPromoter/Enhancer of CMV, used in this study for immunizingBalb/c mice has been described earlier (Arora and Seth, 2001).C. Generating a recombinant virusRecombinant virus was prepared as per manufacturer'sinstructions. Briefly, 35mm tissue culture dishes were seededwith 1x10 6 Spodoptera frugiperda cells (Sf21) (Vaughn et al,1977) in 1.5 ml of complete TNM-FH/FBS medium andincubated overnight at 27 o C in a humid chamber. 500ng ofplasmid pBacBRU-TRE DNA, along with Bsu 361 digestedBacPAK6 viral DNA was mixed with 5µg of lipofectin andincubated at room temperature for 15 min. Culture medium in thetissue culture dishes containing Sf21 cells was replaced with 1.5ml of serum free TNM-FH. Lipofectin-DNA complex was thengently added to Sf21 cells. Plates were incubated at 27 o C for 5hrs. Thereafter, serum free TNM-FH medium was replaced withTNM-FH/FBS medium and the plates were returned forincubation at 27 o C for 4 days.D. Isolation of recombinant virusPlaque assay was performed using co-transfectionsupernatant to generate a pure clone of recombinant virus. 1x10 6Sf21 cells were seeded in 35mm tissue culture dishes andincubated overnight at 27 o C. These cells were then infected with100µl of neat or 10 -1 dilution of co-transfection supernatant. Onehour later, the virus inoculum was removed and infected cellswere overlaid with 1.5ml of agarose (1.5% in TNM-FH/FBS).After agarose was set 1.5 ml of TNM-FH/FBS medium wasadded to each dish and incubated for 4 days at 27 o C. Plaqueswere stained with .03% of neutral red solution. 4 plaques werepicked up and transferred into an eppendorf tube containing500µl of TNM-FH/FBS and stored at 4 o C overnight.E. Virus propagation and evaluationThe plaque picks were used as a source of virus to infectcells in a 96 well plate. Infections were performed in duplicate.Cells were harvested 4 days following infection and cell lysatewas used to perform dot blot analysis to detect the recombinantvirus. Each sample was suspended in 200µl of 0.5N NaOH and20µl of 10M-ammonium acetate. Samples were then spotted onto the nitrocellulose membrane by loading on the wells of the dotblot manifold apparatus (Bio Rad Laboratory, Richmond, CA).Vacuum suction was applied to drain off the entire solution.Membrane was dried at room temperature for 5-10 min and thenbaked for 2 hrs at 80 o C. Hybridization was performed usingα 32 P-dCTP labeled envelope probe prepared by random primerlabeling using Klenow fragment of DNA polymerase 1(Amersham Biosciences, Piscataway, NJ). The membrane wasthen washed and exposed to a Kodak-X film overnight at -70 o C.F. In vitro expressionA time course experiment was performed to examine theexpression of HIV-1 env gene in Sf 21 cells infected with therecombinant virus. Cells were harvested at various time intervalspost infection. SDS PAGE, immunofluorescence and WesternBlot analysis of cell lysate were conducted to study expression ofproteins. SDS-PAGE was performed according to Laemmli. ForWestern Blot analysis proteins were resolved by SDS-PAGE andtransferred onto a nitrocellulose membrane using Trans-blot SDsemi-dry electrophoretic transfer Cell (Bio Rad Laboratories)The membrane was treated with non-fat powdered milk in TTBS(Tween 20- Tris buffer Saline) for 1 hr at room temp. and reactedwith HIV-1 positive human polyclonal serum (at a dilution of1:200) in TBS for 1h at room temperature. After washing thricewith TTBS, the membrane was incubated at room temperaturefor 1 hr. with anti-human IgG conjugated with alkalinephosphatase (1:10,000). Membrane was then washed thrice withTTBS and incubated in the substrate solution (Sigma fastBCIP/NBT tablet dissolved in 10ml of deionized water, SigmaChemicals Co., St. Louis). For Immunofluorescence, P4(recombinant baculovirus) infected cells, uninfected cells(control) and AcNPv (wild type virus) infected cells wereharvested at different time points and washed thrice with PBS.1x10 4 cells were spotted onto the wells of a teflon-coated slideand fixed with acetone: methanol (1:1) at -20 o C for 30 min. Forstaining, cells were allowed to react with HIV-1 positive humanpolyclonal serum (1:50) for 1h at 37 o C. Cells were then washedwith PBS and incubated with FITC conjugated anti-human IgG(Sigma) and incubated for 1hr at 37 o C. Thereafter, the cells werewashed and mounted with glycerol buffer and visualized underfluorescent microscope.G. T cell proliferation assay3 H thymidine uptake assay was used to measure theproliferation of splenocytes after antigenic stimulation. Balb/cmice were immunized intramuscularly with pCIBRU-TRE orpCI (control vector) DNA as described earlier (Arora and Seth,2001). Six groups of Balb/c mice were taken (each groupcomprising 5 mice) (Table 1). In-group D3 three doses of 100 µgDNA each were given at bi-weekly intervals. In D0P2 groupanimals were immunized with 2 doses of P4 with no DNApriming. In-group D3P2 animals were immunized with 3 dosesof pCIBRU-TRE DNA followed by 2 doses of P4. Group D3V2consisted of mice immunized with 3 doses of pCIBRU-TREfollowed by 2 doses of recombinant vaccinia virus expressedgp120 and gp160 (vPE8 and vPE16). D0V2 group consisted ofmice immunized with 2 doses of vPE8 and vPE16 with nopriming with DNA construct and control group. Stimulatingantigens included vaccinia expressed recombinant gp160/gp120(vPE16/ vPE8) and baculovirus expressed gp160 (P4).Splenocytes from various groups of mice were harvested and resuspendedat a concentration of 2x10 6 cells/ml in RPMI 1640medium supplemented with 10% FCS. Cells were stimulated in38