2013 Promega catalogue

Life
Science
Catalog
2013
Worldwide Contact List
Cell Signaling
RNA Polymerase Promoter Sequencing
Primers
Product Size Conc. Cat.# Price ($)
SP6 Promoter Primer 2 μg 10 µg/ml Q5011 137
T7 Promoter Primer 2 μg 10 µg/ml Q5021 137
T7 EEV Promoter Primer 2 μg 10 µg/ml Q6700 134
For Research Use Only. Not for Use in Diagnostic Procedures.
Description: The SP6 and T7 Promoter Primers are designed for sequencing
inserts cloned into the pGEM ® Vectors. The SP6 Promoter Primer is designed
for sequencing inserts cloned into the pALTER ® -MAX and pCI-neo Vectors. The
primers are designed to be annealed to single-stranded DNA or, after alkaline
denaturation, to double-stranded DNA. The promoter primers are purified by gel
electrophoresis or HPLC. The T7 EEV Promoter Primer is suitable for sequencing
the pALTER ® -MAX, pCMVTnT, pTnT and phMGFP Vectors, and the
pCI/pSI series of mammalian expression vectors.
Primer Sequences
• SP6: 5´-d(TATTTAGGTGACACTATAG)-3´
• T7: 5´-d(TAATACGACTCACTATAGGG)-3´
• T7 EEV: 5´-d(AAGGCTAGAGTACTTAATACGA)-3´
Storage Conditions: Store at –20°C.
Ligases
LigaFast Rapid DNA Ligation System
Product Size Cat.# Price ($)
LigaFast Rapid DNA Ligation System 30 reactions M8221 113
150 reactions M8225 371
Available Separately Size Cat.# Price ($)
2X Rapid Ligation Buffer 1.5 ml C6711 156
For Laboratory Use.
Description: The LigaFast Rapid DNA Ligation System is designed for the
efficient ligation of sticky-ended DNA inserts into plasmid vectors in just 5
minutes (blunt-ended inserts in as little as 15 minutes). Rapid ligation is based
on the combination of T4 DNA Ligase with a unique 2X Rapid Ligation Buffer.
The LigaFast System is designed to eliminate any further purification prior
to transformation of ligated DNA. The specially formulated 2X Rapid Ligation
Buffer requires no additional ATP or Mg 2+ addition prior to use.
Features:
• Flexible: Use with 5´, 3´ or blunt-ended DNA inserts.
• Fast: Ligation of cohesive ends in 5 minutes, blunt ends in 15 minutes at
room temperature.
• Convenient: No requirement to purify ligated DNA prior to heat-shock
transformation in E. coli. Ligations conducted at room temperature.
• Ready-To-Use: No additional buffer modifications required prior to use.
• Efficient: Ligations performed using the LigaFast System are comparable
to standard overnight ligations.
• Blue/White Cloning Qualified: Promega’s blue/white cloning assay
provides a higher level of quality control for enzymes used in cloning applications.
Storage Conditions: Store at –20°C.
T4 DNA Ligase
Product Size Conc. Cat.# Price ($)
T4 DNA Ligase 100 u 1–3 u/µl M1801 67
500 u 1–3 u/µl M1804 242
T4 DNA Ligase (HC) 500 u 10–20 u/µl M1794 242
Available Separately Size Cat.# Price ($)
T4 DNA Ligase Buffer Pack 1.5 ml C1263 32
For Laboratory Use.
Description: T4 DNA Ligase catalyzes the joining of two strands of DNA
between the 5´-phosphate and the 3´-hydroxyl groups of adjacent nucleotides
in either a cohesive-ended or blunt-ended configuration. The enzyme has also
been shown to catalyze the joining of RNA to either a DNA or RNA strand in a
duplex molecule but will not join single-stranded nucleic acids.
The T4 DNA Ligase Buffer Pack includes 3 tubes of T4 DNA Ligase 10X Reaction
Buffer. The composition of the 10X reaction buffer is 300mM Tris-HCl (pH
7.8 at 25°C), 100mM MgCl 2 , 100mM DTT and 10mM ATP.
Features:
• Available at High Concentration: Cat.# M1794 contains 500 units of T4
DNA Ligase at 10–20u/μl.
• Flexible: Use with 5´, 3´ or blunt-ended DNA inserts.
• Provided with 10X Reaction Buffer: 300mM Tris-HCl (pH 7.8 at 25°C),
100mM MgCl 2 , 100mM DTT and 10mM ATP.
• Blue/White Cloning Qualified: Promega’s blue/white cloning assay
provides a higher level of quality control for enzymes used in cloning applications.
• Choose Your Configuration: Learn more about our custom options for
this product at: www.promega.com/myway/
Storage Conditions: Store at –20°C.
Protocol
T4 DNA Ligase, Blue/White Cloning Qualified Protocol
T4 RNA Ligase
Part#
9PIM180
Product Size Conc. Cat.# Price ($)
T4 RNA Ligase 500 u 10 u/µl M1051 152
For Research Use Only. Not for Use in Diagnostic Procedures.
Description: T4 RNA Ligase catalyzes the ATP-dependent ligation of singlestranded
RNA or DNA onto the 5´-phosphoryl termini of single-stranded RNA
or DNA. The enzyme, purified from recombinant E. coli CA4 (RNase I-deficient),
has an apparent molecular weight of 43.5kDa. T4 RNA Ligase also catalyzes
the addition of [5´- 32 P] nucleoside 3´,5´-bis (phosphate) onto single-stranded
RNA.
Features:
• May Be Heat-Inactivated: T4 RNA Ligase may be inactivated by heating
at 65°C for 15 minutes.
• Provided with 10X Reaction Buffer: 500mM Tris-HCl (pH 7.8 at 25°C),
100mM MgCl 2 , 50mM DTT, 10mM ATP.
Storage Conditions: Store at –20°C.
Protocol
T4 RNA Ligase Protocol
Part#
9PIM105
Protocol
LigaFast Rapid DNA Ligation System Protocol
Part#
9PIM822
Section
Contents
Table of
Contents
108
For complete and up-to-date product information visit: www.promega.com/catalog