2013 Promega catalogue
2013 Promega catalogue
2013 Promega catalogue
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
Life<br />
Science<br />
Catalog<br />
<strong>2013</strong><br />
Worldwide Contact List<br />
Cell Signaling<br />
RNA Polymerase Promoter Sequencing<br />
Primers<br />
Product Size Conc. Cat.# Price ($)<br />
SP6 Promoter Primer 2 μg 10 µg/ml Q5011 137<br />
T7 Promoter Primer 2 μg 10 µg/ml Q5021 137<br />
T7 EEV Promoter Primer 2 μg 10 µg/ml Q6700 134<br />
For Research Use Only. Not for Use in Diagnostic Procedures.<br />
Description: The SP6 and T7 Promoter Primers are designed for sequencing<br />
inserts cloned into the pGEM ® Vectors. The SP6 Promoter Primer is designed<br />
for sequencing inserts cloned into the pALTER ® -MAX and pCI-neo Vectors. The<br />
primers are designed to be annealed to single-stranded DNA or, after alkaline<br />
denaturation, to double-stranded DNA. The promoter primers are purified by gel<br />
electrophoresis or HPLC. The T7 EEV Promoter Primer is suitable for sequencing<br />
the pALTER ® -MAX, pCMVTnT, pTnT and phMGFP Vectors, and the<br />
pCI/pSI series of mammalian expression vectors.<br />
Primer Sequences<br />
• SP6: 5´-d(TATTTAGGTGACACTATAG)-3´<br />
• T7: 5´-d(TAATACGACTCACTATAGGG)-3´<br />
• T7 EEV: 5´-d(AAGGCTAGAGTACTTAATACGA)-3´<br />
Storage Conditions: Store at –20°C.<br />
Ligases<br />
LigaFast Rapid DNA Ligation System<br />
Product Size Cat.# Price ($)<br />
LigaFast Rapid DNA Ligation System 30 reactions M8221 113<br />
150 reactions M8225 371<br />
Available Separately Size Cat.# Price ($)<br />
2X Rapid Ligation Buffer 1.5 ml C6711 156<br />
For Laboratory Use.<br />
Description: The LigaFast Rapid DNA Ligation System is designed for the<br />
efficient ligation of sticky-ended DNA inserts into plasmid vectors in just 5<br />
minutes (blunt-ended inserts in as little as 15 minutes). Rapid ligation is based<br />
on the combination of T4 DNA Ligase with a unique 2X Rapid Ligation Buffer.<br />
The LigaFast System is designed to eliminate any further purification prior<br />
to transformation of ligated DNA. The specially formulated 2X Rapid Ligation<br />
Buffer requires no additional ATP or Mg 2+ addition prior to use.<br />
Features:<br />
• Flexible: Use with 5´, 3´ or blunt-ended DNA inserts.<br />
• Fast: Ligation of cohesive ends in 5 minutes, blunt ends in 15 minutes at<br />
room temperature.<br />
• Convenient: No requirement to purify ligated DNA prior to heat-shock<br />
transformation in E. coli. Ligations conducted at room temperature.<br />
• Ready-To-Use: No additional buffer modifications required prior to use.<br />
• Efficient: Ligations performed using the LigaFast System are comparable<br />
to standard overnight ligations.<br />
• Blue/White Cloning Qualified: <strong>Promega</strong>’s blue/white cloning assay<br />
provides a higher level of quality control for enzymes used in cloning applications.<br />
Storage Conditions: Store at –20°C.<br />
T4 DNA Ligase<br />
Product Size Conc. Cat.# Price ($)<br />
T4 DNA Ligase 100 u 1–3 u/µl M1801 67<br />
500 u 1–3 u/µl M1804 242<br />
T4 DNA Ligase (HC) 500 u 10–20 u/µl M1794 242<br />
Available Separately Size Cat.# Price ($)<br />
T4 DNA Ligase Buffer Pack 1.5 ml C1263 32<br />
For Laboratory Use.<br />
Description: T4 DNA Ligase catalyzes the joining of two strands of DNA<br />
between the 5´-phosphate and the 3´-hydroxyl groups of adjacent nucleotides<br />
in either a cohesive-ended or blunt-ended configuration. The enzyme has also<br />
been shown to catalyze the joining of RNA to either a DNA or RNA strand in a<br />
duplex molecule but will not join single-stranded nucleic acids.<br />
The T4 DNA Ligase Buffer Pack includes 3 tubes of T4 DNA Ligase 10X Reaction<br />
Buffer. The composition of the 10X reaction buffer is 300mM Tris-HCl (pH<br />
7.8 at 25°C), 100mM MgCl 2 , 100mM DTT and 10mM ATP.<br />
Features:<br />
• Available at High Concentration: Cat.# M1794 contains 500 units of T4<br />
DNA Ligase at 10–20u/μl.<br />
• Flexible: Use with 5´, 3´ or blunt-ended DNA inserts.<br />
• Provided with 10X Reaction Buffer: 300mM Tris-HCl (pH 7.8 at 25°C),<br />
100mM MgCl 2 , 100mM DTT and 10mM ATP.<br />
• Blue/White Cloning Qualified: <strong>Promega</strong>’s blue/white cloning assay<br />
provides a higher level of quality control for enzymes used in cloning applications.<br />
• Choose Your Configuration: Learn more about our custom options for<br />
this product at: www.promega.com/myway/<br />
Storage Conditions: Store at –20°C.<br />
Protocol<br />
T4 DNA Ligase, Blue/White Cloning Qualified Protocol<br />
T4 RNA Ligase<br />
Part#<br />
9PIM180<br />
Product Size Conc. Cat.# Price ($)<br />
T4 RNA Ligase 500 u 10 u/µl M1051 152<br />
For Research Use Only. Not for Use in Diagnostic Procedures.<br />
Description: T4 RNA Ligase catalyzes the ATP-dependent ligation of singlestranded<br />
RNA or DNA onto the 5´-phosphoryl termini of single-stranded RNA<br />
or DNA. The enzyme, purified from recombinant E. coli CA4 (RNase I-deficient),<br />
has an apparent molecular weight of 43.5kDa. T4 RNA Ligase also catalyzes<br />
the addition of [5´- 32 P] nucleoside 3´,5´-bis (phosphate) onto single-stranded<br />
RNA.<br />
Features:<br />
• May Be Heat-Inactivated: T4 RNA Ligase may be inactivated by heating<br />
at 65°C for 15 minutes.<br />
• Provided with 10X Reaction Buffer: 500mM Tris-HCl (pH 7.8 at 25°C),<br />
100mM MgCl 2 , 50mM DTT, 10mM ATP.<br />
Storage Conditions: Store at –20°C.<br />
Protocol<br />
T4 RNA Ligase Protocol<br />
Part#<br />
9PIM105<br />
Protocol<br />
LigaFast Rapid DNA Ligation System Protocol<br />
Part#<br />
9PIM822<br />
Section<br />
Contents<br />
Table of<br />
Contents<br />
108<br />
For complete and up-to-date product information visit: www.promega.com/catalog