April - June 2007 - Kasetsart University

Wisconsin, USA). Total extracted RNA was
applied to 1.2% agarose gels and electrophoresed
in TBE buffer following standard procedures
(Sambrook et al., 1989). A cDNA library was
generated from total RNA using oligo (dT) 15 (DNA
Technology Laboratory, Kasetsart University,
Nakhon Pathom, Thailand) as primers.
SuperScript III reverse transcriptase (Invitrogen,
California, USA) was used for cDNA synthesis
following the standard procedures.
Cloning of the interleukin-2
The synthesized cDNA library was used
as a template for the amplification of IL-2 gene
by two steps RT-PCR. Briefly, PCR master mixture
consisted of 1X PCR buffer, 1.6 mM MgCl 2, 0.5
mM dNTP, 0.25 µmol of specific primers (Table
1) and 1U Platinum Taq DNA polymerase
(Invitrogen, California, USA). The PCR samples
were then denatured at 94°C for 2 min and
continually cycled for 30 times at 94°C for 45 s,
60°C for 45 s and 72°C for 1 min. For complete
amplification, an additional extension step at
72°C for 7 min was included. The PCR products
were analysed in 1.2% agarose gel electrophoresis
and visualized by ethidium bromide staining. The
PCR products were cloned into pDrive cloning
vector (Qiagen, Valencia, USA) and transformed
Kasetsart J. (Nat. Sci.) 41(2) 337
Table 1 Primer sequences used for the amplification of IL-2 and house keeping gene transcripts in
lymphocytes.
Gene primer sequences (5′-3′) Direction Nucleotide Length Reference
position (bp)
IL-2 GCACCCACTTCAAGCTCCACTTC S 61-83 450 -
TTATTGAGGGCTTGTTGAGATGATGC AS 485-510
IL-2 GGATCCGCACCCACTTCAAGC* S 61-75 462 -
GTCGACTTATTGAGGGCTTGTTGAG** AS 478-510
β-actin TGTATTCCCCTCCATCGTG S 87-105 491 (Deng et al., 2000)
GGATCTTCATGAGGTAGTCTGTC AS 555-577
bp: base pair, IL-2: interleukin-2; β-actin: mouse beta-actin; S: sense strand; AS: antisene strand
* sense strand primer with restriction site GGATCC (BamHI)
** antisense strand primer with restriction site GTCGAC (SalI)
into Escherichia coli (DH5α). The transformants
were easily observed by blue/white screening and
the PCR was applied for conformation.
DNA sequence analysis
The DNA from positive clones were
sequenced by the automated DNA sequencer ABI
377 (GMI, Minnesota, USA). Comparison and
multiple alignment of BALB/c nucleotide and
amino acid sequences with those of other mice
strains were carried out using ClustalW version
1.83 with additional manual adjustments.
Expression of rmIL-2 and purification
IL-2 forward and reverse primers
including the restriction site were used for the
amplification of IL-2 gene from the positive
clones. The PCR products were cloned into a
pDrive cloning vector and then transformed into
E. coli (DH5α). The IL-2 gene was amplified and
digested with BamHI/SalI, the IL-2 gene was
ligated into the same sites of the expression vector
pQE30 (Qiagen, Valencia, USA) and then
transformed into E.coli M15 strain by heat shock
method (Sambrook et al., 1989). Screeninng of
the transformants was carried out for ampicillin
and kanamycin resistance. The positive clones
were induced by culturing at 37°C for 5 h in 2YT