April - June 2007 - Kasetsart University

More documents

Recommendations

Info

252 reports revealed that the percentages of callus induction and plant regeneration could be increased by using maltose instead of sucrose (Lentini et al., 1995). In addition, the type of auxin in anther culture medium has been proposed to regulate the formation of rice callus. It was found that culturing on 2,4-D supplemented-media stimulated callus induction and cell proliferation in rice anther culture whereas having NAA resulted in direct androgenesis (Ball et al., 1993). This work aimed at investigating the effects of maltose, sucrose and 2,4-D on the anther culture response of the BC 1F 1 hybrid of two recalcitrant genotypes, Khao Dawk Mali 105 (KDML105) a well-known aromatic rice variety and IRBB5 a bacterial blight resistant rice variety containing xa5 resistant gene. In addition, the regeneration ability of the anther calli was also observed. After anther culture-derived plants (ACderived plants) were obtained, the Amplified Fragment Length Polymorphism (AFLP) was used to assess the contribution of the two parental genomes in these plants, and subsequent detection of xa5 resistant gene for bacterial blight resistance was done using PCR-based marker. MATERIALS AND METHODS BC 1F 1 seeds culturing and panicles collection BC 1F 1 seeds (KDML105//IRBB5/ KDML105) were obtained from the crossing between KDML 105 (a bacterial blight susceptible variety) and IRBB5 (the donor parent containing xa5 bacterial blight resistant gene). The BC 1F 1 seeds were cultured on a modified MS medium (Murashige and Skoog, 1962) supplemented with 2-3 mg/l BAP, 1 g/l yeast extract, 15% coconut water, 30 g/l sucrose and 0.8% agar. The BC 1F 1 plants having xa5 gene were selected by PCRbased RG556 marker (Huang et al., 1997). Healthy tillers from the selected BC 1F 1 plants were separated and grown in pots. The panicles were collected from the primary, secondary and also <strong>Kasetsart</strong> J. (Nat. Sci.) 41(2) tertiary tillers of plants when the microspores in anther were at the mid-to-late uninucleate stage as seen from the distance between the auricles of the two last leaves that reached 6-12 cm. Anther culture The panicles covered with flag-leaf sheaths were wrapped in a moist-soft paper, sealed in a plastic bag, and kept in the dark for 8-10 days at 12°C. After this cold-pretreatment, the panicles were surface-sterilized by spraying with 70% ethanol and the flag-leaf sheaths were removed. Then the anthers were cut off and cultured on callus induction media containing N 6 salts and vitamins (Chu, 1978), supplemented with 2 mg/l NAA, 1 mg/l kinetin, 500 mg/l casein hydrolysate, 0.7% agar and also different concentrations of maltose or sucrose (40 , 50 , 60 g/l) at the adjusted pH of 5.8. The cultures were maintained under alternate 16/8 h light/dark at 25 ± 2°C for 45-50 days. The numbers of anther calli formation were recorded and the percentages of calli induction were calculated. The experiment was set as 2×3 factorial in completely randomized design with three replications. An addition of 2 mg/l of 2,4-D to callus induction medium of the same formular described above having 50 g/l maltose was also performed to determine the effect of 2,4-D on callus induction. Callus differentiation Anther calli of 1-2 mm diameter were randomly collected and transferred to the regeneration media consisted of MS salts and vitamins, supplemented with different concentrations of kinetin (1, 2, 3 mg/l), 300 mg/l casein hydrolysate, 1 g/l L-proline, 15% coconut water, 30 g/l sucrose and 2.5 g/l phytagel. An addition of regeneration medium having 2 mg/l BAP and 0.2mg/l NAA to replace kinetin and Lproline was set. The cultures were kept under alternate 16/8 h light/dark at 25 ± 2°C for 15-20
days. The numbers of calli producing complete plantlets were recorded and the percentage were calculated. AFLP analysis To assess the contribution of two parental genomes in AC-derived plants, AFLP was performed as described by Vos et al. (1995) with some modification. Fifteen combinations of primer (synthesized by KU Vector), set E primer (EcoRI end) and set M primer (MseI end), were used. Only clear AFLP bands were scored as present or absent. AFLP fingerprints of KDML105, IRBB5 and also AC-derived plants were analyzed. Detection of xa5 resistant gene for bacterial blight resistance by PCR-based marker The DNA of the resistant donor parent (IRBB5), recurrent susceptible parent (KDML105), and AC-derived plants were extracted from the leaves using the method described by Agrawal et al. (1992) and subjected to PCR amplification using synthesized primers (KU Vector). The RG556 primer linked to the xa5 resistant gene was used to detect the presence of resistant gene. The sequence of RG556 F is 5′ TAGC TGCTGCCGTGCTGTGC 3′ while RG556 <strong>Kasetsart</strong> J. (Nat. Sci.) 41(2) 253 R is 5′ AATATTTCAGTGTGCATCTC 3′ (Huang et al., 1997). PCR products were digested with Hpy CH4 IV restriction enzyme to detect the polymorphic DNA bands from bacterial blight resistant and susceptible plants (Sanchez et al., 2000). RESULTS AND DISCUSSION Anther culture Ten days after incubation on callus induction media, approximately 90% of anthers turned brown (data not shown). This result, however, was not surprising because Guzman and Zapata-Arias (2000) also reported this changing of anther colors which is possibly due to the transition of gametophytic phase to sporophytic phase during androgenesis. In addition, our results showed that anther calli asynchronously emerged through the split lobes of these browning anthers after 45-50 days of culturing (Figure 1A). Most of the responding anthers produced multiple calli which ultimately became yellowish in color having both campact and friable callus types (Figure 1B). The calli were all in satisfactory condition. This is the first report on anther culture of BC 1F 1 seeds (KDML105//IRBB5/KDML105). Figure 1 Calli formation: (A) calli emerged through the split lobes of anther (arrow), (B) the anther calli (arrow), after 45-50 days of culturing on callus induction media containing maltose.
Page 1 and 2: April - June 2007 Volume 41 Number
Page 3 and 4: KASETSART JOURNAL NATURAL SCIENCE T
Page 5 and 6: Kasetsart J. (Nat. Sci.) 41 : 205 -
Page 7 and 8: harvesting time which started from
Page 9 and 10: y Chen and Paull (2000). Figure 1 a
Page 11 and 12: pineapple fruit allowed the accumul
Page 15 and 16: Kasetsart J. (Nat. Sci.) 41(2) 215
Page 17 and 18: Cluster analysis Cluster analysis u
Page 21 and 22: Table 3 (Continued) 1 2 3 4 5 6 7 8
Page 25 and 26: CONCLUSION AFLP markers classified
Page 29 and 30: difference of soil texture used in
Page 31 and 32: under wet soil condition planting.
Page 33 and 34: tropics. Following the expansion, w
Page 35 and 36: sealed in a plastic box with 1 cm w
Page 37 and 38: moisture content increment after so
Page 39 and 40: Frequency Frequency 30 20 10 0 20.0
Page 41 and 42: School, Kasetsart University. The a
Page 43 and 44: for combining ability of lines (Lam
Page 45 and 46: selective mass sibbing within indiv
Page 47 and 48: Although most of S 2-interfamily hy
Page 49 and 50: composite sets as used in this stud
Page 51: Kasetsart J. (Nat. Sci.) 41 : 251 -
Page 55 and 56: the report of Ching (1982) showing
Page 57 and 58: clearly amplified bands generated b
Page 59 and 60: caused by either the recombination
Page 61 and 62: Kuhlmann, V. and B. Foroughi-Wehr.
Page 63 and 64: Xanthomonas fuscans subsp. aurantif
Page 67 and 68: was collected and washed with 70% e
Page 69 and 70: expected size was amplified with 35
Page 71 and 72: eaction technique has been used for
Page 73 and 74: Schaad, N.W., D. Opgenorth and P. G
Page 75 and 76: MATERIALS AND METHODS Model descrip
Page 79 and 80: calculated TF value calculated TF v
Page 81 and 82: sincere gratitude and deep apprecia
Page 83 and 84: 1989). In monogastrics, the inclusi
Page 85 and 86: of all LLS samples in this study we
Page 87 and 88: Melbourne, Parkville, Victoria. Goe
Page 89 and 90: considered responsible for low prod
Page 93 and 94: mineral supplementation suggested b
Page 95 and 96: Body weight chane (kg/head) 32 30 2
Page 97 and 98: CONCLUSION AND RECOMMENDATION With
Page 99 and 100: SAS. (Statistical Analysis System).
Page 101 and 102: genes covering a variety of desirab
Page 103 and 104:
mg/l NAA and 0.5 mg/l zeatin) incub
Page 105 and 106:
5. Purification by various sucrose
Page 107 and 108:
as the culture period increased. So
Page 109 and 110:
culture, pp. 1-20. In L.C. Fowke an
Page 111 and 112:
Kasetsart J. (Nat. Sci.) 41 : 311 -
Page 113 and 114:
GC. Analytical methods Total carboh
Page 115 and 116:
ash. The crude hot water polysaccha
Page 117 and 118:
spirulan (H-SP), and a desulfated c
Page 119 and 120:
Page 121 and 122:
cells often displayed an increased
Page 123 and 124:
LITERATURE CITED Bell, T.A. and D.V
Page 125 and 126:
for alternative sources of supply.
Page 127 and 128:
BR2.1.2 formed the same clade with
Page 129 and 130:
supplement with glutamate (Iida et
Page 131 and 132:
optimal for S. limacinum BR2.1.2 fo
Page 133 and 134:
fluorescent lamp at 1.5 kLux develo
Page 135 and 136:
Page 137 and 138:
Wisconsin, USA). Total extracted RN
Page 139 and 140:
RESULTS Cloning and sequencing of m
Page 141 and 142:
Expression of rmIL-2 and purificati
Page 143 and 144:
other strains of mice have differen
Page 145 and 146:
dose interleukin-2 therapy promotes
Page 147 and 148:
The chitosano-oligosaccharides are
Page 149 and 150:
enzyme and cells were maximized by
Page 151 and 152:
of crude chitosanases. Fortunately,
Page 153 and 154:
Relative activity (%) 100 80 60 40
Page 155 and 156:
Uchida, K. Tateishi, O. Shida and K
Page 157 and 158:
MATERIALS AND METHODS 1. Materials
Page 159 and 160:
without coating and coated with pec
Page 161 and 162:
in Table 5-7. It was found that the
Page 163 and 164:
Page 165 and 166:
the cultures at 10,200 × g for 15
Page 167 and 168:
incubation and reached the final pH
Page 169 and 170:
y lysine- and tyrosine-decarboxylas
Page 171 and 172:
during the stages of ripening as su
Page 173 and 174:
Page 175 and 176:
As the 25 companies were divided in
Page 177 and 178:
All the data comes up with informat
Page 179 and 180:
as piece “A” or straight as pie
Page 181 and 182:
et al. (1998); Zeng (2000); and Tal
Page 183 and 184:
p 1, i * Kasetsart J. (Nat. Sci.) 4
Page 185 and 186:
c ≤ c2 jq2 j n q p k p * 2, j , ,
Page 187 and 188:
algorithm would consider RM 5, prio
Page 189 and 190:
Kasetsart J. (Nat. Sci.) 41(2) 389
Page 191 and 192:
the maximum deviation of about 10%.
Page 193 and 194:
Stock Quantities Using Heuristic Op
Page 195 and 196:
which dynamically and automatically
Page 197 and 198:
2. Framework architecture and compo
Page 199 and 200:
Risk (VaR) calculation which was im
Page 201 and 202:
Throughput (job/sec) 7 6 5 4 3 2 1
Page 203 and 204:
Speed up 40 35 30 25 20 15 10 5 0 F
Page 205 and 206:
and discovery, resource selection a
show all

April - June 2007 - Kasetsart University

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?