April - June 2007 - Kasetsart University

More documents

Recommendations

Info

268 <strong>Kasetsart</strong> J. (Nat. Sci.) 41(2) Table 2 Comparison of specificity test of 354 F/R, VM3-VM4, KF-KR and 2-3 primers by classical PCR. Specific amplification product of each primer pair was determined on agarose gel at concentration of 1% for 354 F/R primers and 1.5% for VM3-VM4, KF-KR and 2-3 primers in 0.5x TBE buffer. Xanthomonas species PCR primers 354F-354R VM3-VM4 KF-KR 2-3 X. citri subsp. citri (23) y 23 z 23 23 23 X. fuscans subsp. aurantifolii (10) 0 5 0 0 X. alfalfae subsp. citrumelonis (2) 0 0 0 0 X. citri subsp. malvacearum (9) 0 9 0 9 X. fuscans subsp. fuscans (1) 0 0 0 0 X. campestris pv. campestris (1) 0 0 0 0 X. campestris pv. glycines (11) 0 9 0 0 y Total number of Xanthomonas species in specificity test. z Total number of classical PCR positive results of each Xanthomonas species and 0 = negative result. Figure 1 A) PCR amplification products of 354 F/R primers on 1% agarose gel 0.5x TBE buffer. B) Southern blot hybridization with 354 bp probe of Xanthomonas species. Lane 1) DNA marker 1 kb (Biolab ® ); 2-5) X. citri subsp. citri: T7, J131, 1258, 1270; 6-11) X. fuscans subsp. aurantifolii: 1415, 1416, 1419, 1420, 1360, 1361; 12-13) X. alfalfae subsp. citrumelonis: 1267, 1274; 14) X. campestris pv. glycines: NKR 21; 15) X. citri subsp. malvacearum: 1318; 16) X. fuscans subsp. fuscans: 1316; 17) X. campestris pv. campestris: 657.
expected size was amplified with 354 F/R primers from 34 strains of other xanthomonads including 10 strains of X. fuscans subsp. aurantifolii, 2 strains of X. alfalfae subsp. citrumelonis, 9 strains of X. citri subsp. malvacearum, 1 strain of X. fuscans subsp. fuscans, 1 strain of X. campestris pv. campestris and 11 strains of X. campestris pv. glycines (Table 2). Other primer pairs, VM3-VM4, KF-KR and 2-3, also amplified expected fragment of PCR product from all strains of Xcc (Table 2). However, VM3-VM4 primers still provided the expected fragment from 5 strains of X. fuscans subsp. aurantifolii including 1 strain of B-strain <strong>Kasetsart</strong> J. (Nat. Sci.) 41(2) 269 and 4 strains of C-strain, 9 strains of X. citri subsp. malvacearum and 9 strains of X. campestris pv. glycines. The KF-KR primers were not crossreacted to other xanthomonads. The 2-3 primers also gave expected fragment from 9 strains of X. citri subsp. malvacearum. PCR sensitivity Sensitivity of 354 F/R primers for detection of viable cells of Xcc and purified total DNA of Xcc strain T7 were 70 cells per µl and 50 pg per µl (Figure 3), respectively by PCR reaction and amplification program were followed as previously. Xsc(T7) 1 GACGGCGCGGCTCAGGATGCTGCTAAGGGAGCTGGACGCGCGAAAGGTAATCTGGAAGAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AE011881.1 4675 GACGGCGCGGCTCAGGATGCTGCTAAGGGAGCTGGACGCGCGAAAGGTAATCTGGAAGAC 4734 Xsc(T7) 61 CAGCTGCGTGTTGCCAACGAGCTACTGCGTGGC * TTGCAAATCCTTGGCATTAGCGACGAA 120 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| AE011881.1 4735 CAGCTGCGTGTTGCCAACGAGCTACTGCGTGGT * TTGCAAATCCTTGGCATTAGCGACGAA 4794 Xsc(T7) 121 GCCGAAGCGTTGGAGCAGGACCTCACCGGGATCTTAAATGCCTTTTCAAAGTCGATTCTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AE011881.1 4795 GCCGAAGCGTTGGAGCAGGACCTCACCGGGATCTTAAATGCCTTTTCAAAGTCGATTCTG 4854 Xsc(T7) 181 CAAAGTGAAAGAGGGATCGCGACTGCTGAGGAGGCTAGACGCGAGCAGGCTCTCAATACG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AE011881.1 4855 CAAAGTGAAAGAGGGATCGCGACTGCTGAGGAGGCTAGACGCGAGCAGGCTCTCAATACG 4914 Xsc(T7) 241 CTTGTTGCATTTCTAATGAGCTTCGCGAGCCGAAGCGGCGTACGTGATCGACTGAACATC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AE011881.1 4915 CTTGTTGCATTTCTAATGAGCTTCGCGAGCCGAAGCGGCGTACGTGATCGACTGAACATC 4974 Xsc(T7) 301 TTTACCACCAACTATGACAGGCTAATCGAAGCTGGTGCTGAGTTGGCTGGGCTG 354 |||||||||||||||||||||||||||||||||||||||||||||||||||||| AE011881.1 4975 TTTACCACCAACTATGACAGGCTAATCGAAGCTGGTGCTGAGTTGGCTGGGCTG 5028 Figure 2 Comparison of nucleotide sequences of PCR product fragment of 354 F/R primers from Xanthomonas citri subsp. citri (T7 strain) and Xanthomonas axonopodis pv. citri strain 306 gene XAC 2443 (Accession AE011881) with BlastN program showed 99.7% similarity * non-similar nucleotide
Page 1 and 2:
April - June 2007 Volume 41 Number
Page 3 and 4:
KASETSART JOURNAL NATURAL SCIENCE T
Page 5 and 6:
Kasetsart J. (Nat. Sci.) 41 : 205 -
Page 7 and 8:
harvesting time which started from
Page 9 and 10:
y Chen and Paull (2000). Figure 1 a
Page 11 and 12:
pineapple fruit allowed the accumul
Page 13 and 14:
Page 15 and 16:
Kasetsart J. (Nat. Sci.) 41(2) 215
Page 17 and 18: Cluster analysis Cluster analysis u
Page 19 and 20: Kasetsart J. (Nat. Sci.) 41(2) 219
Page 21 and 22: Table 3 (Continued) 1 2 3 4 5 6 7 8
Page 25 and 26: CONCLUSION AFLP markers classified
Page 27 and 28: Kasetsart J. (Nat. Sci.) 41 : 227 -
Page 29 and 30: difference of soil texture used in
Page 31 and 32: under wet soil condition planting.
Page 33 and 34: tropics. Following the expansion, w
Page 35 and 36: sealed in a plastic box with 1 cm w
Page 37 and 38: moisture content increment after so
Page 39 and 40: Frequency Frequency 30 20 10 0 20.0
Page 41 and 42: School, Kasetsart University. The a
Page 43 and 44: for combining ability of lines (Lam
Page 45 and 46: selective mass sibbing within indiv
Page 47 and 48: Although most of S 2-interfamily hy
Page 49 and 50: composite sets as used in this stud
Page 53 and 54: days. The numbers of calli producin
Page 55 and 56: the report of Ching (1982) showing
Page 57 and 58: clearly amplified bands generated b
Page 59 and 60: caused by either the recombination
Page 61 and 62: Kuhlmann, V. and B. Foroughi-Wehr.
Page 63 and 64: Xanthomonas fuscans subsp. aurantif
Page 67: was collected and washed with 70% e
Page 71 and 72: eaction technique has been used for
Page 73 and 74: Schaad, N.W., D. Opgenorth and P. G
Page 75 and 76: MATERIALS AND METHODS Model descrip
Page 79 and 80: calculated TF value calculated TF v
Page 81 and 82: sincere gratitude and deep apprecia
Page 83 and 84: 1989). In monogastrics, the inclusi
Page 85 and 86: of all LLS samples in this study we
Page 87 and 88: Melbourne, Parkville, Victoria. Goe
Page 89 and 90: considered responsible for low prod
Page 93 and 94: mineral supplementation suggested b
Page 95 and 96: Body weight chane (kg/head) 32 30 2
Page 97 and 98: CONCLUSION AND RECOMMENDATION With
Page 99 and 100: SAS. (Statistical Analysis System).
Page 101 and 102: genes covering a variety of desirab
Page 103 and 104: mg/l NAA and 0.5 mg/l zeatin) incub
Page 105 and 106: 5. Purification by various sucrose
Page 107 and 108: as the culture period increased. So
Page 109 and 110: culture, pp. 1-20. In L.C. Fowke an
Page 113 and 114: GC. Analytical methods Total carboh
Page 115 and 116: ash. The crude hot water polysaccha
Page 117 and 118: spirulan (H-SP), and a desulfated c
Page 119 and 120:
Page 121 and 122:
cells often displayed an increased
Page 123 and 124:
LITERATURE CITED Bell, T.A. and D.V
Page 125 and 126:
for alternative sources of supply.
Page 127 and 128:
BR2.1.2 formed the same clade with
Page 129 and 130:
supplement with glutamate (Iida et
Page 131 and 132:
optimal for S. limacinum BR2.1.2 fo
Page 133 and 134:
fluorescent lamp at 1.5 kLux develo
Page 135 and 136:
Page 137 and 138:
Wisconsin, USA). Total extracted RN
Page 139 and 140:
RESULTS Cloning and sequencing of m
Page 141 and 142:
Expression of rmIL-2 and purificati
Page 143 and 144:
other strains of mice have differen
Page 145 and 146:
dose interleukin-2 therapy promotes
Page 147 and 148:
The chitosano-oligosaccharides are
Page 149 and 150:
enzyme and cells were maximized by
Page 151 and 152:
of crude chitosanases. Fortunately,
Page 153 and 154:
Relative activity (%) 100 80 60 40
Page 155 and 156:
Uchida, K. Tateishi, O. Shida and K
Page 157 and 158:
MATERIALS AND METHODS 1. Materials
Page 159 and 160:
without coating and coated with pec
Page 161 and 162:
in Table 5-7. It was found that the
Page 163 and 164:
Page 165 and 166:
the cultures at 10,200 × g for 15
Page 167 and 168:
incubation and reached the final pH
Page 169 and 170:
y lysine- and tyrosine-decarboxylas
Page 171 and 172:
during the stages of ripening as su
Page 173 and 174:
Page 175 and 176:
As the 25 companies were divided in
Page 177 and 178:
All the data comes up with informat
Page 179 and 180:
as piece “A” or straight as pie
Page 181 and 182:
et al. (1998); Zeng (2000); and Tal
Page 183 and 184:
p 1, i * Kasetsart J. (Nat. Sci.) 4
Page 185 and 186:
c ≤ c2 jq2 j n q p k p * 2, j , ,
Page 187 and 188:
algorithm would consider RM 5, prio
Page 189 and 190:
Kasetsart J. (Nat. Sci.) 41(2) 389
Page 191 and 192:
the maximum deviation of about 10%.
Page 193 and 194:
Stock Quantities Using Heuristic Op
Page 195 and 196:
which dynamically and automatically
Page 197 and 198:
2. Framework architecture and compo
Page 199 and 200:
Risk (VaR) calculation which was im
Page 201 and 202:
Throughput (job/sec) 7 6 5 4 3 2 1
Page 203 and 204:
Speed up 40 35 30 25 20 15 10 5 0 F
Page 205 and 206:
and discovery, resource selection a
show all

April - June 2007 - Kasetsart University

Create successful ePaper yourself

Delete template?

Save as template?