Revision of Passiflora Subgenus Decaloba ... - Passion Flowers

425
DNA polymerase (Sigma-Aldrich; 0.04 U/µL), the included buffers (1X), MgCl2
(4.5 mM), and primers (each 0.2 µM). A hot start at 95ºC for 10 minutes was
followed by 40 cycles of 94ºC for 45 seconds, 57ºC for one minute and 15
seconds, and 72ºC for two minutes. Amplification was completed with a 10-
minute elongation step at 72ºC to maximize A-tailing and increase efficiency of
cloning into T-tailed vectors. The alignment of six dicot GBSSI sequences
(Ipomoea carnea Jacq.: GenBank AF111128; Manihot esculenta Crantz:
GenBank X74160; Phaseolus vulgaris L.: GenBank AB029546; Prunus
virginiana L.: GenBank AF285991; Solanum tuberosum L.: GenBank X83220;
and Symphoricarpos albus (L.) S.F. Blake: GenBank AF277633) was used by
Mark Whitten and I to design amplification primers 2F (TGGTGGACT
YGGTGATGTTC) and 10R (TCTTCTAGYCTRCCAATGAASC) (Fig. A.1).
Primers 2F and 10R were used to amplify a product approximately 1,700 base
pairs in length, spanning 7 exons and 8 introns. Subsequently, primers 558F
(TAGAGCAGGAGAGGATTACC) and -561R (AGATTGAGGAGCGAGAAGTC)
were designed from alignments of Passiflora supersection Cieca GBSSI
sequences to facilitate sequencing the middle of the amplified region (Fig. A.1).
PCR products were cleaned using QIAquick columns (Qiagen, Santa Clarita,
California, USA) and underwent dye terminator cycle sequencing with Applied
Biosystems Inc. (ABI) (Foster City, California, USA) reagents (5µL reactions).
The GBSSI region for members of supersection Cieca was sequenced directly
from the cleaned amplified product in the DNA Sequencing Core Facility on the
University of Florida campus (DSEQ, UF) with ABI 377 and ABI 373A automated