Dokument 1.pdf - OPUS - Universität Würzburg

Weitere Magazine

Empfehlungen

Info

9 Anhang Tabelle 9.2: Kontrollen (Housekeeping Gene) Gen ID Name/Funktion Oligonukleotidsequenz ACTB NM_001101 Aktin B ALAS NM_000688 Aminolevulinat Delta- synthase 1 ATP6V1A NM_001690 ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A CD81 NM_004356 CD81-Molekül EEA1 NM_003566 early endosome antigen 1 GAPDH NM_002046 GOLGA4 NM_002078 Glyceraldehyd-3phosphatdehydrogenase golgi autoantigen, golgin subfamily a, 4 MYO1C NM_033375 Myosin 1C NIPB NM_031466 PECR NM_018441 PSMA7 NM_002792 Trafficking protein particle complex 9 peroxisomal trans-2-enoyl-CoA reductase proteasome (prosome, macropain) subunit, alpha type, 7 USP49 NM_018561 ubiquitin specific peptidase 49 ZNF710 NM_198526 Zinkfingerprotein 710 Tabelle 9.3: Kontrollen (Aspergillus Gene) - 125- gctcattgccaatggtgatgacctggccgtcaggcagctc gtagctcttctccag gaatctaggtggagaagaagccactcatccatccaggca gggaagactcttaggg tatgaaacttgtttaattggctccacttaggaccagacacag cacaataaatacagaactgcatcatc gtagggcctggtcatagaactgcttcacatccttggcgatct ggtccttgttgac caactgacagcgagggtaagaagctttctaagattctaaat ggacaatgcgtggg ggtctctctcttcctcttgtgctcttgctggggctggtggtcc aggggtcttact tgcagcactttctgactcaagcctatcttccaatgcctttaac tcctcctctttg aaaggccctacatccttgagtggggcccgagtgtgcggg caagctgtctgtcatc ttgaacttgtccacttgaatagccattcgctggcactcgccg gcgtgcaggatga agccactgcgtctggcctctacctttacaattaaataataaa atcttctgggagttcatgatccctagaa tgcttcagactggcgatgtagcgggtgatgtactccacagt gaccgggtcctcca cttgaggttacacaggttctactgtttctgcataaccaagaa ggaaactggggtgtgca tggggtcttggctgtccaggccgatgtctatgacgccatgc ttgaccttcatgtg Gen ID Name/Funktion Oligonukleotidsequenz FKS1 NC_007199 P-(1,3)-Glucansynthase SidA AY586511 L-ornithine N5-oxygenase SidA Rho1 AY007297 Rho GTPase Rho1 gcgacgtcctggcctctgagaacaaacgatctcaatgtcgt gtggattgccaaatgtacaataccat atggcggatatcgtgttcacaggttccctcatgtctgctccg tcttccggagttccaatcgtgttgtcag accagttattggagacgcttatccgttgataaaatctccgaa ttgaaacagaccttttgcgaaggagacg
9 Anhang 9.3 Publikationsliste 9.3.1 Veröffentlichungen In press bei Journal of Basic Microbiology: - 126- 40-0-[2-Hydroxyethyl]rapamycin modulates human dendritic cell function during exposure to Aspergillus fumigatus. Ruth Bauer, Markus Mezger, Christian Blockhaus, Anna-Lena Schmitt, Oliver Kurzai, Hermann Einsele and Juergen Loeffler. 40-0-[2-Hydroxyethyl]rapamycin (RAD), a novel derivate of the immunosuppressive drug rapamycin, was analyzed for its immune-modulatory influence during the interaction of human monocyte-derived dendritic cells (moDCs) with Aspergillus fumigatus. RAD is clinically used to prevent graft-versus-host disease, as well as solid organ and bone marrow transplant rejection. However, it may constitute risk factors for the development of opportunistic infections, such as invasive aspergillosis, which is mainly caused by the most common airborne fungal pathogen A. fumigatus. moDCs were generated in the presence or absence of RAD. In this settings RAD had various modulating effects on the immune function of DCs. A decrease of pro- and anti-inflammatory cytokines (IL-12, TNFα, CCL20 and IL10) was observed. Furthermore, RAD reduced the expression of innate immunity receptors (TLR2, TLR4 and dectin-1), impaired the maturation capacity of moDCs, observed through the reduction of co-stimulatory factors (CD40, CD80, CD83 and CD86), and impaired capacity of phagocytosis and damage of A. fumigatus. These data demonstrate that RAD influences the differentiation of moDCs. RAD modulates the cytokine response of moDCs to A. fumigatus and reduces their ability to kill germ tubes. Thus, RAD treatment might affect the risk for invasive aspergillosis independently of its blocking capacity for T-cell activation.
Seite 1 und 2:
Interaktionen von humanen Immuneffe
Seite 3 und 4:
Erklärung Die vorliegende Arbeit w
Seite 5 und 6:
Inhaltsverzeichnis Inhaltsverzeichn
Seite 7 und 8:
Inhaltsverzeichnis 5.7.1 Infektion
Seite 9 und 10:
Inhaltsverzeichnis 9.3.1 Veröffent
Seite 11 und 12:
1 Zusammenfassung Kontrollzellen ze
Seite 13 und 14:
2 Summary A home-made RNA microarra
Seite 15 und 16:
3 Einleitung wichtig für die sexue
Seite 17 und 18:
3 Einleitung 3.2 Das Immunsystem in
Seite 19 und 20:
3 Einleitung prozessiert und präse
Seite 21 und 22:
3 Einleitung Rezeptor (IL-1Rs) mit
Seite 23 und 24:
3 Einleitung Zudem konnten C-Typ Le
Seite 25 und 26:
3 Einleitung gebildet wird, ist IL1
Seite 27 und 28:
3 Einleitung Abbildung 3.4:Schemati
Seite 29 und 30:
3 Einleitung 3.4.2 40-0-[2-Hydroxye
Seite 31 und 32:
3 Einleitung 3.5 Ziele der Arbeit F
Seite 33 und 34:
4 Materialien β-Mercaptoethanol Si
Seite 35 und 36:
4 Materialien IL12 IL12 LC CAG TTA
Seite 37 und 38:
4 Materialien Na-Citrat Fluka (Seel
Seite 39 und 40:
4 Materialien 4.4.6 Agar-Platten Di
Seite 41 und 42:
4 Materialien LightCycler ® Capill
Seite 43 und 44:
5 Methoden mit 0,1 mg Fluorescein-I
Seite 45 und 46:
5 Methoden Abbildung 5.1: Gitternet
Seite 47 und 48:
5 Methoden 5.3.6 Generierung von He
Seite 49 und 50:
5 Methoden 5.3.9 Isolation von neut
Seite 51 und 52:
5 Methoden Tabelle 5.1: Liste der O
Seite 53 und 54:
5 Methoden 5.4.3 Einfrieren von Zel
Seite 55 und 56:
5 Methoden Durchführung erfolgte s
Seite 57 und 58:
5 Methoden Appendix D: Optional On-
Seite 59 und 60:
5 Methoden 10 µl 2x QuantiFast Pro
Seite 61 und 62:
5 Methoden 5.7.5.3 Agarose-Gelelekt
Seite 63 und 64:
5 Methoden 5.8 Konfrontationsunters
Seite 65 und 66:
5 Methoden 5.8.4 Phagozytose-Assay
Seite 67 und 68:
6 Ergebnisse 6 Ergebnisse 6.1 Kontr
Seite 69 und 70:
6 Ergebnisse In dieser Studie wurde
Seite 71 und 72:
6 Ergebnisse Deshalb wurde ein Wach
Seite 73 und 74:
6 Ergebnisse 6.4 Einfluss von RAD a
Seite 75 und 76:
6 Ergebnisse anglich. Aus diesem Er
Seite 77 und 78:
6 Ergebnisse erhalten, wurde ein Ze
Seite 79 und 80:
6 Ergebnisse 89 % ± 7 % weniger TN
Seite 81 und 82:
6 Ergebnisse 6.4.5 Phagozytose von
Seite 83 und 84: 6 Ergebnisse Zeitpunkte wurden in A
Seite 85 und 86: 6 Ergebnisse Zytotoxische T-Lymphoz
Seite 87 und 88: 6 Ergebnisse A. fumigatus hochregul
Seite 89 und 90: 6 Ergebnisse Tabelle 6.3: Different
Seite 91 und 92: 6 Ergebnisse 6.5.2 Expressionsanaly
Seite 93 und 94: 6 Ergebnisse Abbildung 6.21: Schmel
Seite 95 und 96: 6 Ergebnisse silencing) bzw. Medium
Seite 97 und 98: 7 Diskussion 7 Diskussion In dieser
Seite 99 und 100: 7 Diskussion Es wurde bei neutrophi
Seite 101 und 102: 7 Diskussion 7.1.4 Der Einfluss von
Seite 103 und 104: 7 Diskussion die pathologisch ist,
Seite 105 und 106: 7 Diskussion Obwohl RAD die Funktio
Seite 107 und 108: 7 Diskussion für die erfolgreiche
Seite 109 und 110: 7 Diskussion - 100- sich mit siRNA
Seite 111 und 112: 8 Literaturverzeichnis - 102- 16. B
Seite 113 und 114: 8 Literaturverzeichnis - 104- 45. C
Seite 115 und 116: 8 Literaturverzeichnis - 106- 74. G
Seite 117 und 118: 8 Literaturverzeichnis - 108- 105.
Seite 125 und 126: 9 Anhang 9 Anhang 9.1 Abkürzungen
Seite 127 und 128: 9 Anhang complex) min Einheit: Minu
Seite 129 und 130: 9 Anhang TLR9 NM_017442 Toll-like R
Seite 131 und 132: 9 Anhang CXCL 13 NM_006419 CXCL 14
Seite 133: 9 Anhang TXN NM_003329 Thioredoxin
Seite 137 und 138: 9 Anhang 9.4 Lebenslauf Persönlich
Seite 139: Markus Mezger und Dr. med. Christia
Alle anzeigen

Dokument 1.pdf - OPUS - Universität Würzburg

Sie wollen auch ein ePaper? Erhöhen Sie die Reichweite Ihrer Titel.

Template löschen?

Als Template speichern?