plant surface microbiology.pdf

578
Gopi K. Podila and Luisa Lanfranco
1. Insert DNAs can be PCR-amplified directly from bacterial colonies with
oligonucleotides designed on sequences flanking the cloning site 5T (5¢
CTCGGGAAGCGCGCCATTGTGTTGG 3¢) and 3T (5¢ ATACGACTCAC-
TATAGGGCGAATTGGCC 3¢). PCR reactions carried out in a final volume
of 50 ml containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.1 mM MgCl 2,
0.01 % gelatin, 200 mM dNTPs, 50 pmol of each primer and 2 U of RedTaq
DNA polymerase (Sigma, St. Louis, MO, USA). The following amplification
program is run in a Hybaid thermal cycler: 3 min at 95 °C (1 cycle); 45 s at
92 °C, 45 s at 55 °C, 2 min at 72 °C (30 cycles).
2. PCR products should be separated by gel electrophoresis (Sambrook and
Russel 2001).
5 Troubleshooting
Possible contaminations by ribosomal sequences (18S and 28S rRNAs might
contain stretches of A that can complement oligo d-T).
Remedial actions: when a sufficient amount of total RNA is available, purify the
poly-A RNA by using oligo d-T affinity columns (Sambrook and Russel 2001).
Inserts with small size
Remedial actions: enrichment of high molecular weight cDNAs through fractionation
into a column.
6 Sequencing Strategies
Single run sequences of 250–700 bases are determined in most cases using an
automated sequencer such as ABI Prism or Beckman CEQ 8 or other
sequencers, whose accuracy has been estimated to be greater than 95 %.
Because of the large number of sequences that needs to be processed in a relatively
short time, it is advisable to outsource the sequencing process (private
companies can do the service for a high number of sequences for a relatively
low price). For people who have access to their own automated sequencers, we
found Big Dye cycle sequencing kit from ABI (ABI, Foster City, CA, USA) or
the DynamicET cycle sequencing kit from Amersham (Amersham Pharmacia
Biotech, Piscataway, NJ, USA) give very good results. Both kits can be used to
scale down the reactions to quarter reactions and still produce very good
sequence reads, and makes it very economical. Since cDNAs are cloned into
the pTriplex vector in a defined orientation, it is advisable to carry out the
sequencing from the 5¢-end first so as to obtain coding region information
from each EST.
Note: If you use quarter reactions, purity of plasmid DNA and quantity are
critical. Sequencing of the 3¢-end could help to identify cDNAs derived from the
same mRNA, but which are truncated at different positions at the 5¢-end.