Industrial Biotransformations

More documents

Recommendations

Info

4.2 Learning from Nature Nature itself appears to provide a solution to the apparent dilemma of the frequent incompatibilities of enzyme properties and organic chemistry: natural evolution produces enzyme variants by mutation and subsequently tests activity by selecting the “fittest” variant. This process can be mimicked in a test-tube using modern molecular biological methods of site directed or random mutagenesis and subsequent analysis of the enzyme activity. This collection of (molecular) biological methods has been termed “molecular engineering”, which provides a powerful tool for the development of biocatalysts with novel properties. Before beginning an enzyme optimization by means of molecular engineering, three requirements are necessary: (a) the enzyme coding gene must be known and isolated from gene-libraries or amplified directly from genomic DNA using PCR; (b) the identified gene must be cloned into an appropriate expression vector for production of the enzymatically active biocatalyst; and (c) the analysis of enzymatic activity must be established to identify changes in biocatalyst properties. In the age of complete genome [9–13] and environmental genome sequencing [14] projects, the availability of gene sequences do not usually constitute a major drawback to molecular engineering approaches. However, having the gene in ones hands does not as a consequence mean that the catalytically active enzyme is actually available. Therefore, one essential requirement is the availability of powerful expression systems based on homologous or heterologous microbial hosts, as described in the next section. 4.3 Enzyme Production Using Bacterial Expression Hosts An efficient bacterial overexpression system consists of a vector harboring the gene (or genes) of interest under the control of a promoter that might be regulated by trans-acting elements (so-called regulatory proteins) leading to a modulated gene expression in the prokaryotic host cell. These expression vectors are naturally occurring extra-chromosomal DNA, so-called plasmids, usually carrying resistance genes enabling the cells to survive in toxic environments or to cope with antibiotic attacks from other microorganisms. One of the first and best-studied “general purpose” cloning vectors is pBR322 1 . This plasmid, isolated by Bolivar and Rodriguez et al. [15], consists of 4361 base pairs. As shown in Fig. 4.1(A), pBR322 contains two antibiotic resistance genes (ampicillin and tetracycline), an origin of replication for Escherichia coli as the host cell and unique 1) Plasmid names usually start with a “p”, which is the abbreviation for plasmid. The subsequent letters and/or numbers are abbreviations chosen by the scientist who created or isolated the plasmid. In the case of pBR322, the letters represent the 4.3 Enzyme Production Using Bacterial Expression Hosts initials from the molecular biology scientists Bolivar and Rodriguez, whereas the “322” is a serial number. 95
(A) (B) (C) Pst EcoRI 96 HindIII Amp 4 Optimization of <strong>Industrial</strong> Enzymes by Molecular Engineering ori BamHI PstI pET-vector pUC18/19 Tet pBR322 Amp Amp lacI ori SalI PstI His-tag MCS lacZ´ gene PT7 MCS ori Bpu1102 NdeI Bgl II NdeI EheI P T7 P lac rbs His-tag ATG lacO MCS lacZ´ gene Bgl II T7 promoter lac operator HincII SalI XbaI BamHI SmaI KpnI SacI EcoRI HindIII PaeI PstI AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCC AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC pUC18 XbaI rbs NcoI His-tag TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCCATCATCATCATCATCATCAT His His His His His His His His-tag Enterokinase NdeI XhoI BamHI HincII EcoRI SacI KpnI SmaI BamHI XbaI SalI PstI PaeI HindIII pUC19 CATCATCACAGCAGCGGCCATATCGACGACGACGACAAGCATATGCTCGAGGATCCGGCTGCTAAC His His His Ser Ser Gly His Ile Asp Asp Asp Asp Lys His Met Leu Glu Asp Pro Ala Ala Asn GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT AAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGG Lys Ala Arg Lys Glu Ala Glu Leu Ala Ala Ala Thr Ala Glu Gln End GCCTCTAAACGGGTCTTGAGGGGTTTTTTG (e.g., HindIII, EcoRI or BamHI). In pUC- and pET-vectors many unique restriction sites are located in multiple cloning sites (MCS) enabling convenient cloning of the target gene. For a tightly controlled overexpression, the pET-vector series contain the T7 promoter (PT7), the lactose operator (lacO) and the ribosome binding site (rbs) in front of the ATGstart codon. Fig. 4.1 Genetic map of cloning and expression vectors. (A) Cloning vector pBR322 [15], (B) pUC-vectors [16] and (C) pET-vectors (Novagen, Madison, WI, USA) are given in a schematic overview. All plasmids contain typical expression vector elements such as ampicillin (Amp) or tetracycline (Tet) resistance genes, an origin of replication (ori) and unique restriction endonuclease recognition sites
Page 2 and 3:
Industrial Biotransformations Edite
Page 4 and 5:
Industrial Biotransformations Secon
Page 6 and 7:
Contents Preface to the first editi
Page 8 and 9:
5 Basics of Bioreaction Engineering
Page 10 and 11:
X Preface to the first edition many
Page 12 and 13:
XII Preface to the second edition E
Page 14 and 15:
XIV List of Contributors Prof. Dr.
Page 16 and 17:
2 1 History of Industrial Biotransf
Page 18 and 19:
Page 20 and 21:
Page 22 and 23:
Page 24 and 25:
10 1 History of Industrial Biotrans
Page 26 and 27:
Page 28 and 29:
Page 30 and 31:
R' 16 O H N 1 History of Industrial
Page 32 and 33:
Page 34 and 35:
Page 36 and 37:
Page 38 and 39:
Page 40 and 41:
Page 42 and 43:
Page 44 and 45:
Page 46 and 47:
Page 48 and 49:
Page 50 and 51:
Page 52 and 53:
38 2 The Enzyme Classification Tab.
Page 54 and 55:
40 2 The Enzyme Classification trib
Page 56 and 57:
42 2 The Enzyme Classification EC 1
Page 58 and 59: 44 2 The Enzyme Classification EC 1
Page 68 and 69: 54 2 The Enzyme Classification 2.2.
Page 70 and 71: 56 2 The Enzyme Classification The
Page 74 and 75: 60 2 The Enzyme Classification in g
Page 76 and 77: 62 2 The Enzyme Classification Refe
Page 78 and 79: 64 3 Retrosynthetic Biocatalysis 3.
Page 80 and 81: 66 3 Retrosynthetic Biocatalysis R
Page 90 and 91: 76 3 Retrosynthetic Biocatalysis R
Page 92 and 93: 78 3 Retrosynthetic Biocatalysis Wh
Page 102 and 103: 88 3 Retrosynthetic Biocatalysis Re
Page 104 and 105: 90 3 Retrosynthetic Biocatalysis (D
Page 106 and 107: 4 Optimization of Industrial Enzyme
Page 110 and 111: 4.3 Enzyme Production Using Bacteri
Page 112 and 113: 4.4 Improvements to Enzymes by Mole
Page 114 and 115: 1 4.4 Improvements to Enzymes by Mo
Page 116 and 117: 4.4 Improvements to Enzymes by Mole
Page 118 and 119: 4.5 Identification of Improved Enzy
Page 120 and 121: 4.5 Identification of Improved Enzy
Page 122 and 123: Galleron, N., Ghim, S.Y., Glaser, P
Page 124 and 125: ment, Relaxation, and Reversal of t
Page 126 and 127: 81 Goddard, J.-P., Reymond, J.-L. 2
Page 128 and 129: 5 Basics of Bioreaction Engineering
Page 130 and 131: where r p = selectivity to componen
Page 132 and 133: 5.1 Definitions operoxidase (CPO) h
Page 134 and 135: 5.1 Definitions The residence time
Page 136 and 137: 5.1 Definitions In iso-electric pre
Page 138 and 139: 5.2 Biocatalyst Kinetics formation
Page 140 and 141: 5.2 Biocatalyst Kinetics K M values
Page 142 and 143: v ˆ V max ‰SŠ KM 1‡ ‰PŠ KI
Page 144 and 145: 5.3 Basic Reactor Types and their M
Page 146 and 147: dx concentration [S] 0 [S] 1 [S] e
Page 148 and 149: 5.4 Biocatalyst Recycling and Recov
Page 150 and 151: . better stability, especially towa
Page 152 and 153: 5.4.2 Cross-linking 5.4 Biocatalyst
Page 154 and 155: . immobilization methods . substrat
Page 156 and 157: References Owing to the need for st
Page 158 and 159:
40 Vuorilehto, K., Lütz, S., Wandr
Page 160 and 161:
Common name of enzyme Name of strai
Page 162 and 163:
Common name of enzyme Name of strai
Page 164 and 165:
Alcohol dehydrogenase Neurospora cr
Page 166 and 167:
Alcohol dehydrogenase Neurospora cr
Page 168 and 169:
Alcohol dehydrogenase Rhodococcus e
Page 170 and 171:
Alcohol dehydrogenase Rhodococcus e
Page 172 and 173:
Alcohol dehydrogenase Acinetobacter
Page 174 and 175:
Alcohol dehydrogenase Acinetobacter
Page 176 and 177:
Dehydrogenase Zygosaccharomyces rou
Page 178 and 179:
Alcohol dehydrogenase Lactobacillus
Page 180 and 181:
Page 182 and 183:
Page 184 and 185:
Carbonyl reductase Escherichia coli
Page 186 and 187:
Aldehyde reductase Escherichia coli
Page 188 and 189:
Lactate dehydrogenase Staphylococcu
Page 190 and 191:
d-Lactate dehydrogenase Leuconostoc
Page 192 and 193:
d-Lactate dehydrogenase Leuconostoc
Page 194 and 195:
d-Sorbitol dehydrogenase Gluconobac
Page 196 and 197:
d-Sorbitol dehydrogenase Gluconobac
Page 198 and 199:
Dehydrogenase Geotrichum candidum 1
Page 200 and 201:
Ketoreductase 1 = ethyl-4-chloro-3-
Page 202 and 203:
Dehydrogenase Candida sorbophila N
Page 204 and 205:
Dehydrogenase Candida sorbophila N
Page 206 and 207:
Reductase Pichia methanolica 1 = Et
Page 208 and 209:
Reductase Aureobasidium pullulans S
Page 210 and 211:
Reductase Nocardia salmonicolor SC
Page 212 and 213:
Glutamate dehydrogenase / Glucose 1
Page 214 and 215:
Leucine dehydrogenase Bacillus spha
Page 216 and 217:
Leucine dehydrogenase Bacillus spha
Page 218 and 219:
Phenylalanine dehydrogenase / Forma
Page 220 and 221:
d-Aminoacid oxidase Trijonopsis var
Page 222 and 223:
d-Amino acid oxidase Trigonopsis va
Page 224 and 225:
Nicotinic acid hydroxylase Achromob
Page 226 and 227:
Nicotinic acid hydroxylase Achromob
Page 228 and 229:
Catalase Microbial source 1) Reacti
Page 230 and 231:
Oxygenase Arthrobacter sp. 1) React
Page 232 and 233:
Naphthalene dioxygenase Pseudomonas
Page 234 and 235:
Naphthalene dioxygenase Pseudomonas
Page 236 and 237:
Benzoate dioxygenase Pseudomonas pu
Page 238 and 239:
Cyclohexanone monooxygenase Acineto
Page 240 and 241:
Cyclohexanone monooxygenase Acineto
Page 242 and 243:
Oxygenase Escherichia coli OH OH 1
Page 244 and 245:
Monooxygenases / Aryl alcohol dehyd
Page 246 and 247:
Styrene monooxygenase Escherichia c
Page 248 and 249:
Styrene monooxygenase Escherichia c
Page 250 and 251:
Monooxygenase Pseudomonas putida H
Page 252 and 253:
Monooxygenase Streptomyces sp. SC 1
Page 254 and 255:
Oxygenase Nocardia autotropica 1) R
Page 256 and 257:
Monooxygenase Nocardia corallina 1
Page 258 and 259:
Monooxygenase Nocardia corallina
Page 260 and 261:
Monooxygenase Nocardia corallina O
Page 262 and 263:
Oxidase Pseudomonas oleovorans 1) R
Page 264 and 265:
Reductase Baker’s yeast 1 = oxois
Page 266 and 267:
Oxidase Rhodococcus erythropolis 2
Page 268 and 269:
Desaturase Rhodococcus sp. 1) React
Page 270 and 271:
Desaturase Rhodococcus sp. 3) Flow
Page 272 and 273:
Oxidase Beauveria bassiana 1) React
Page 274 and 275:
Oxidase Beauveria bassiana ● The
Page 276 and 277:
Cyclodextrin glycosyltransferase Ba
Page 278 and 279:
d-Amino acid transaminase Bacillus
Page 280 and 281:
d-Amino acid transaminase Bacillus
Page 282 and 283:
Transaminase Bacillus megaterium 1)
Page 284 and 285:
Lipase Burkholderia plantarii 2 (R,
Page 286 and 287:
Lipase Burkholderia plantarii 3) Fl
Page 288 and 289:
Lipase Pseudomonas cepacia 1 = cis-
Page 290 and 291:
Lipase Pseudomonas cepacia 5) Produ
Page 292 and 293:
Lipase Pseudomonas cepacia 2 F 1 =
Page 294 and 295:
Lipase Pseudomonas cepacia 6) Liter
Page 296 and 297:
Lipase Mucor miehei Fig. 3.1.1.3 -
Page 298 and 299:
Lipase Mucor miehei 6) Literature E
Page 300 and 301:
Lipase Porcine pancreas 5) Product
Page 302 and 303:
Lipase Pseudomonas fluorescens Fig.
Page 304 and 305:
Lipase Pseudomonas fluorescens O O
Page 306 and 307:
Lipase Candida cylindracea ● In c
Page 308 and 309:
Lipase Candida antarctica 2 F 1) Re
Page 310 and 311:
Lipase Candida antarctica ● It sh
Page 312 and 313:
Lipase Candida antarctica ● The p
Page 314 and 315:
Lipase Candida antarctica 3) Flow s
Page 316 and 317:
Lipase Arthrobacter sp. ● For thi
Page 318 and 319:
Lipase Serratia marescens MeO R MeO
Page 320 and 321:
Lipase Serratia marescens Fig. 3.1.
Page 322 and 323:
Lipase Pseudomonas cepacia 1) React
Page 324 and 325:
Lipase Candida antarctica 1) Reacti
Page 326 and 327:
Lipase Candida antarctica 4) Proces
Page 328 and 329:
-Galactosidase Saccharomyces lactis
Page 330 and 331:
Lipase Pseudomonas cepacia ● The
Page 332 and 333:
Lactonase Fusarium oxysporum 1 = pa
Page 334 and 335:
Lactonase Fusarium oxysporum Fig. 3
Page 336 and 337:
Lactonase Fusarium oxysporum 5) Pro
Page 338 and 339:
Glutaryl amidase Escherichia coli F
Page 340 and 341:
Glutaryl amidase Escherichia coli 6
Page 342 and 343:
Glutaryl amidase Pseudomonas sp. 3)
Page 344 and 345:
a-Amylase / Amyloglucosidase Bacill
Page 346 and 347:
Nucleosidase / Phosphorylase Erwini
Page 348 and 349:
Aminopeptidase Pseudomonas putida 1
Page 350 and 351:
Aminopeptidase Pseudomonas putida
Page 352 and 353:
Aminopeptidase Pseudomonas putida 3
Page 354 and 355:
Aminopeptidase Pseudomonas putida
Page 356 and 357:
Carboxypeptidase B Pig Pancreas 3)
Page 358 and 359:
Page 360 and 361:
Page 362 and 363:
Trypsin Pig Pancreas 2) Remarks ●
Page 364 and 365:
Page 366 and 367:
Page 368 and 369:
Subtilisin Bacillus licheniformis 1
Page 370 and 371:
Page 372 and 373:
Subtilisin Bacillus licheniformis
Page 374 and 375:
Page 376 and 377:
Subtilisin Bacillus licheniformis
Page 378 and 379:
Subtilisin Bacillus sp. EtOOC (R/S)
Page 380 and 381:
Subtilisin Bacillus sp. drug discov
Page 382 and 383:
Subtilisin Bacillus lentus 1 = (R,S
Page 384 and 385:
Thermolysin Bacillus thermoproteoly
Page 386 and 387:
Thermolysin Bacillus thermoproteoly
Page 388 and 389:
Amidase Comamonas acidovorans 1) Re
Page 390 and 391:
Amidase Klebsiella terrigena 2 H N
Page 392 and 393:
Amidase Klebsiella terrigena 6) Lit
Page 394 and 395:
Amidase Klebsiella oxytoca company:
Page 396 and 397:
Urease Lactobacillus fermentum ●
Page 398 and 399:
Penicillin amidase Escherichia coli
Page 400 and 401:
Page 402 and 403:
Penicillin amidase Bacillus megater
Page 404 and 405:
Page 406 and 407:
Page 408 and 409:
Penicillin acylase Escherichia coli
Page 410 and 411:
Page 412 and 413:
Page 414 and 415:
Aminoacylase Aspergillus niger 2 N
Page 416 and 417:
Aminoacylase Aspergillus niger 3) F
Page 418 and 419:
Aminoacylase Aspergillus oryzae S C
Page 420 and 421:
Aminoacylase Aspergillus oryzae 3)
Page 422 and 423:
d-Hydantoinase Bacillus brevis Fig.
Page 424 and 425:
d-Hydantoinase Bacillus brevis 3) F
Page 426 and 427:
Hydantoinase / Carbamoylase Pseudom
Page 428 and 429:
l-Hydantoinase Arthrobacter sp. DSM
Page 430 and 431:
l-Hydantoinase Arthrobacter sp. DSM
Page 432 and 433:
-Lactamase Aureobacterium sp. 3) Fl
Page 434 and 435:
-Lactamase Pseudomonas solanacearum
Page 436 and 437:
Lactamase / Racemase Cryptococcus l
Page 438 and 439:
Nitrilase Acidovorax facilis 1 = 2-
Page 440 and 441:
Nitrilase Escherichia coli 1) React
Page 442 and 443:
Nitrilase / Hydroxylase Agrobacteri
Page 444 and 445:
Nitrilase / Hydroxylase Alcaligenes
Page 446 and 447:
Dehalogenase Pseudomonas putida 1)
Page 448 and 449:
Dehalogenase Pseudomonas putida 5)
Page 450 and 451:
Haloalkane dehalogenase Alcaligenes
Page 452 and 453:
Haloalkane dehalogenase Alcaligenes
Page 454 and 455:
Haloalkane dehalogenase Enterobacte
Page 456 and 457:
Halohydrin dehalogenase 1 = ethyl-(
Page 458 and 459:
Pyruvate decarboxylase Saccharomyce
Page 460 and 461:
Acetolactate decarboxylase Bacillus
Page 462 and 463:
Aspartate b-decarboxylase Pseudomon
Page 464 and 465:
Aspartate b-decarboxylase Pseudomon
Page 466 and 467:
Oxynitrilase Hevea brasiliensis 1 =
Page 468 and 469:
N-Acetyl-d-neuraminic acid aldolase
Page 470 and 471:
N-Acetyl-d-neuraminic acid aldolase
Page 472 and 473:
Tyrosine phenol lyase Erwinia herbi
Page 474 and 475:
Fumarase Corynebacterium glutamicum
Page 476 and 477:
Fumarase Corynebacterium glutamicum
Page 478 and 479:
Fumarase Brevibacterium flavum 4) P
Page 480 and 481:
Enoyl-CoA hydratase Candida rugosa
Page 482 and 483:
Enoyl-CoA hydratase Candida rugosa
Page 484 and 485:
Tryptophan synthase Escherichia col
Page 486 and 487:
Malease Pseudomonas pseudoalcaligen
Page 488 and 489:
Malease Pseudomonas pseudoalcaligen
Page 490 and 491:
Nitrile hydratase Pseudomonas chlor
Page 492 and 493:
Nitrile hydratase Rhodococcus rhodo
Page 494 and 495:
Page 496 and 497:
Page 498 and 499:
Page 500 and 501:
Carnitine dehydratase Escherichia c
Page 502 and 503:
Page 504 and 505:
Page 506 and 507:
Aspartase Escherichia coli 3) Flow
Page 508 and 509:
Aspartase Escherichia coli 5) Produ
Page 510 and 511:
Aspartase Brevibacterium flavum 3)
Page 512 and 513:
l-Aspartase Escherichia coli 3) Flo
Page 514 and 515:
l-Phenylalanine ammonia-lyase Rhodo
Page 516 and 517:
Amino acid racemase Amycolatopsis o
Page 518 and 519:
GlcNAc 2-epimerase Escherichia coli
Page 520 and 521:
Xylose isomerase Bacillus coagulans
Page 522 and 523:
Xylose isomerase Bacillus coagulans
Page 524 and 525:
a-Glucosyl transferase Protaminobac
Page 526 and 527:
516 7 Quantitative Analysis of Indu
Page 528 and 529:
Page 530 and 531:
Page 532 and 533:
522 Index of enzyme name enzyme nam
Page 534 and 535:
524 Index of enzyme name enzyme nam
Page 536 and 537:
526 Index of strain strain enzyme n
Page 538 and 539:
Page 540 and 541:
Page 542 and 543:
532 Index of company company strain
Page 544 and 545:
534 Index of company company strain
Page 546 and 547:
536 Index of starting material star
Page 548 and 549:
Page 550 and 551:
Page 552 and 553:
Page 554 and 555:
Page 556 and 557:
546 Index of product product enzyme
Page 558 and 559:
Page 560 and 561:
Page 562 and 563:
Page 564 and 565:
Page 566:
show all

Industrial Biotransformations

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?