116
9 Literatur 1. Abbas, A.K. (2005) Cellular and Molecular Immunology. W.B. Saunders Company. 2. Aderem, A. and Ulevitch, R.J. (2000) Toll-like receptors <strong>in</strong> the <strong>in</strong>duction of the <strong>in</strong>nate immune response. Nature, 406, 782-787. 3. Aigner, S., Sthoeger, Z.M., Fogel, M., Weber, E., Zarn, J., Ruppert, M., Zeller, Y., Vestweber, D., Stahel, R., Sammar, M. and Altevogt, P. (1997) CD24, a muc<strong>in</strong>-type glycoprote<strong>in</strong>, is a ligand for P-select<strong>in</strong> on human tumor cells. Blood, 89, 3385-3395. 4. Akira, S. and Takeda, K. (2004) Toll-like receptor signall<strong>in</strong>g. Nat Rev Immunol, 4, 499-511. 5. Alexopoulou, L., Holt, A.C., Medzhitov, R. and Flavell, R.A. (2001) Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature, 413, 732-738. 6. Arancia, G., Str<strong>in</strong>garo, A., Crateri, P., Torosantucci, A., Ramoni, C., Urbani, F., Ausiello, C.M. and Cassone, A. (1998) Interaction between human <strong>in</strong>terleuk<strong>in</strong>- 2-activated natural killer cells and heat-killed germ tube forms of <strong>Candida</strong> <strong>albicans</strong>. Cell Immunol, 186, 28-38. 7. Ashwell, J.D. (2006) The many paths to p38 mitogen-activated prote<strong>in</strong> k<strong>in</strong>ase activation <strong>in</strong> the immune system. Nat Rev Immunol, 6, 532-540. 8. Baldw<strong>in</strong>, A.S., Jr. (1996) The NF-kappa B and I kappa B prote<strong>in</strong>s: new discoveries and <strong>in</strong>sights. Annu Rev Immunol, 14, 649-683. 9. Baldw<strong>in</strong>, A.S., Jr. (2001) Series <strong>in</strong>troduction: the transcription factor NFkappaB and human disease. J Cl<strong>in</strong> Invest, 107, 3-6. 10. Bastert, J., Schaller, M., Kort<strong>in</strong>g, H.C. and Evans, E.G. (2001) Current and future approaches to antimycotic treatment <strong>in</strong> the era of resistant fungi and immunocompromised hosts. Int J Antimicrob Agents, 17, 81-91. 11. Beekhuizen, H. and van Furth, R. (1993) Monocyte adherence to human vascular endothelium. J Leukoc Biol, 54, 363-378. 12. Bellocchio, S., Montagnoli, C., Bozza, S., Gaziano, R., Rossi, G., Mambula, S.S., Vecchi, A., Mantovani, A., Levitz, S.M. and Romani, L. (2004) The 117
- Seite 1:
Candida albicans-induzierte Genexpr
- Seite 5:
Alles Wissen und alles Vermehren un
- Seite 8 und 9:
2.10 siRNAs (Doppelstrang-Oligonukl
- Seite 10 und 11:
4.3.6 Der C. albicans-induzierten C
- Seite 13 und 14:
1 Einleitung 1.1 Der Hefepilz Candi
- Seite 15 und 16:
1.1.2 Pathogenese und Virulenzfakto
- Seite 17 und 18:
gekennzeichneter Befall der Zunge,
- Seite 19 und 20:
Chemokinen, immunregulatorischen Ob
- Seite 21 und 22:
1.4 Der p38 MAP Kinase-Signalweg Di
- Seite 23 und 24:
PAMPs und deren TLRs spezifischen M
- Seite 25 und 26:
eine Reihe von Autophosphorylierung
- Seite 27:
Mit der vorliegenden Arbeit sollte
- Seite 30 und 31:
6 x Probenpuffer für Agarose-Gelel
- Seite 32 und 33:
2.5 Antikörper 2.5.1 Antikörper f
- Seite 34 und 35:
Dulbecco’s modified Eagle’s Med
- Seite 36 und 37:
2.11 Zellen, Pilze und Bakterien HU
- Seite 39 und 40:
3 Methoden 3.1 Zellkultur Alle Zell
- Seite 41 und 42:
3.1.2.4 ΦNX ampho und FLYRD-18 Die
- Seite 43 und 44:
3.2.1 Retrovirale Infektion von HUV
- Seite 45 und 46:
94 µl OptiMEM) versetzt. Beide Lö
- Seite 47 und 48:
Abbildung 3.2 Darstellung der Oligo
- Seite 49 und 50:
VCAM-1 ACATGGAATTCGAACCCAAACA GGCTG
- Seite 51 und 52:
3.6.2 Proteintransfer Für den immu
- Seite 53 und 54:
wurden die stimulierten Zellen mit
- Seite 55 und 56:
Kontrollen gemessen. Dafür wurden
- Seite 57 und 58:
3.11.6 Konzentrationsbestimmung von
- Seite 59 und 60:
Klonierung: Für die vorliegende Ar
- Seite 61 und 62:
4 Ergebnisse 4.1 Etablierung eines
- Seite 63 und 64:
Für weitere Versuche wurde, soweit
- Seite 65 und 66:
der Co-Kultur letztendlich zum Zell
- Seite 67 und 68:
Hitze-Inaktivierung auf einer Sabou
- Seite 69 und 70:
4.2 Untersuchung des C. albicans-in
- Seite 71 und 72:
waren Gene, die im Zusammenhang mit
- Seite 73 und 74:
IκBα-Phosphorylierung innerhalb v
- Seite 75 und 76:
Selektion war die geforderte Mindes
- Seite 77 und 78: 4.3.4 Die C. albicans-induzierte Ex
- Seite 79 und 80: 4.3.5 Die C. albicans-induzierte Ex
- Seite 81 und 82: Hypothese eines indirekten Mechanis
- Seite 83 und 84: 4.4 C. albicans aktiviert die p38 M
- Seite 85 und 86: Abbildung 4.21 Die C. albicans-indu
- Seite 87 und 88: CXCL8-Synthese und die κB-kontroll
- Seite 89 und 90: HEK293-Zelllinien jeweils mit spezi
- Seite 91 und 92: transfizierten Zellen kaum beeinflu
- Seite 93 und 94: Abbildung 4.28 Eine shRNA gegen IRA
- Seite 95 und 96: unterschiedlicher Antikörper im We
- Seite 97 und 98: Die deutliche Abhängigkeit der C.
- Seite 99 und 100: Abbildung 4.33 Die Poly(I:C)-induzi
- Seite 101 und 102: 5 Diskussion Die Interaktion von hu
- Seite 103 und 104: Bedingungen in HUVEC herunterreguli
- Seite 105 und 106: subendotheliale glatte Muskelzellen
- Seite 107 und 108: Ausgehend von diesem Ergebnis konnt
- Seite 109 und 110: stress-aktivierte Protein-1 Kinase
- Seite 111 und 112: N-verknüpfte Mannosylreste an den
- Seite 113 und 114: dominant-negativen Mutanten beider
- Seite 115 und 116: 5.7 Ausblick In dieser Arbeit konnt
- Seite 117 und 118: 6 Anhang 6.1 Endotheliale Gene, die
- Seite 119 und 120: 212803_at Zhangfei NGFI-A binding p
- Seite 121 und 122: 221795_at neurotrophic tyrosine kin
- Seite 123 und 124: 217683_at hemoglobin, epsilon 1 2.6
- Seite 125 und 126: 7 Zusammenfassung Endothelzellen si
- Seite 127: 8 Summary Endothelial cells (ECs) a
- Seite 131 und 132: lectin DC-SIGN (CD209) is an antige
- Seite 133 und 134: 44. Ghannoum, M.A., Swairjo, I. and
- Seite 135 und 136: interleukin-8 synthesis integrates
- Seite 137 und 138: 84. Langeggen, H., Namork, E., John
- Seite 139 und 140: MacCallum, D.M., Odds, F.C., Van de
- Seite 141 und 142: albicans Invasin That Binds to Cadh
- Seite 143 und 144: 147. Slutsky, B., Staebell, M., And
- Seite 145 und 146: aid in diagnosing systemic candidia
- Seite 147 und 148: involves degradation of IkappaBalph
- Seite 149 und 150: 10 Abkürzungen M molar mA Milliamp
- Seite 151 und 152: 11 Danksagung Die vorliegende Arbei
- Seite 153 und 154: 12 Lebenslauf Persönliche Daten Vo
- Seite 155 und 156: 13 Publikationsliste 13.1 Publikati
- Seite 157: 14 Erklärung Hiermit erkläre ich