95. Medzhitov, R. and Janeway, C., Jr. (2000) Innate immunity. N Engl J Med, 343, 338-344. 96. Medzhitov, R. and Janeway, C.A., Jr. (1997) Innate immunity: impact on the adaptive immune response. Curr Op<strong>in</strong> Immunol, 9, 4-9. 97. Medzhitov, R., Preston-Hurlburt, P. and Janeway, C.A., Jr. (1997) A human homologue of the Drosophila Toll prote<strong>in</strong> signals activation of adaptive immunity. Nature, 388, 394-397. 98. Meylan, E., Tschopp, J. and Kar<strong>in</strong>, M. (2006) Intracellular pattern recognition receptors <strong>in</strong> the host response. Nature, 442, 39-44. 99. Michiels, C. (2003) Endothelial cell functions. J Cell Physiol, 196, 430-443. 100. Morris, G.E., Parker, L.C., Ward, J.R., Jones, E.C., Whyte, M.K., Brightl<strong>in</strong>g, C.E., Bradd<strong>in</strong>g, P., Dower, S.K. and Sabroe, I. (2006) Cooperative molecular and cellular networks regulate Toll-like receptor-dependent <strong>in</strong>flammatory responses. Faseb J, 20, 2153-2155. 101. Morschhäuser, J., Virkola, R., Korhonen, T.K. and Hacker, J. (1997) Degradation of human subendothelial extracellular matrix by prote<strong>in</strong>asesecret<strong>in</strong>g <strong>Candida</strong> <strong>albicans</strong>. FEMS Microbiol Lett, 153, 349-355. 102. Mostefaoui, Y., Claveau, I. and Rouabhia, M. (2004) In vitro analyses of tissue structure and <strong>in</strong>terleuk<strong>in</strong>-1beta expression and production by human oral mucosa <strong>in</strong> response to <strong>Candida</strong> <strong>albicans</strong> <strong>in</strong>fections. Cytok<strong>in</strong>e, 25, 162- 171. 103. Müller, V., Viemann, D., Schmidt, M., Endres, N., Ludwig, S., Leverkus, M., Roth, J. and Goebeler, M. <strong>Candida</strong> <strong>albicans</strong> triggers activation of dist<strong>in</strong>ct signal<strong>in</strong>g pathways to establish a pro<strong>in</strong>flammatory gene expression program <strong>in</strong> primary human endothelial cells. J Immunol, <strong>in</strong> press. 104. Nathan, C. (2002) Po<strong>in</strong>ts of control <strong>in</strong> <strong>in</strong>flammation. Nature, 420, 846- 852. 105. Navarro-Garcia, F., Sanchez, M., Nombela, C. and Pla, J. (2001) Virulence genes <strong>in</strong> the pathogenic yeast <strong>Candida</strong> <strong>albicans</strong>. FEMS Microbiol Rev, 25, 245-268. 106. Netea, M.G., Gow, N.A., Munro, C.A., Bates, S., Coll<strong>in</strong>s, C., Ferwerda, G., Hobson, R.P., Bertram, G., Hughes, H.B., Jansen, T., Jacobs, L., Buurman, E.T., Gijzen, K., Williams, D.L., Torensma, R., McK<strong>in</strong>non, A., 126
MacCallum, D.M., Odds, F.C., Van der Meer, J.W., Brown, A.J. and Kullberg, B.J. (2006a) Immune sens<strong>in</strong>g of <strong>Candida</strong> <strong>albicans</strong> requires cooperative recognition of mannans and glucans by lect<strong>in</strong> and Toll-like receptors. J Cl<strong>in</strong> Invest, 116, 1642-1650. 107. Netea, M.G., Sutmuller, R., Hermann, C., Van der Graaf, C.A., Van der Meer, J.W., van Krieken, J.H., Hartung, T., Adema, G. and Kullberg, B.J. (2004a) Toll-like receptor 2 suppresses immunity aga<strong>in</strong>st <strong>Candida</strong> <strong>albicans</strong> through <strong>in</strong>duction of IL-10 and regulatory T cells. J Immunol, 172, 3712-3718. 108. Netea, M.G., Van der Graaf, C., Van der Meer, J.W. and Kullberg, B.J. (2004b) Recognition of fungal pathogens by Toll-like receptors. Eur J Cl<strong>in</strong> Microbiol Infect Dis, 23, 672-676. 109. Netea, M.G., van der Graaf, C., Van der Meer, J.W. and Kullberg, B.J. (2004c) Toll-like receptors and the host defense aga<strong>in</strong>st microbial pathogens: br<strong>in</strong>g<strong>in</strong>g specificity to the <strong>in</strong>nate-immune system. J Leukoc Biol, 75, 749-755. 110. Netea, M.G., Van Der Graaf, C.A., Vonk, A.G., Verschueren, I., Van Der Meer, J.W. and Kullberg, B.J. (2002) The role of toll-like receptor (TLR) 2 and TLR4 <strong>in</strong> the host defense aga<strong>in</strong>st dissem<strong>in</strong>ated candidiasis. J Infect Dis, 185, 1483-1489. 111. Netea, M.G., van der Meer, J.W. and Kullberg, B.J. (2006b) Both TLR2 and TLR4 are <strong>in</strong>volved <strong>in</strong> the recognition of <strong>Candida</strong> <strong>albicans</strong>. Reply to "TLR2, but not TLR4, triggers cytok<strong>in</strong>e production by mur<strong>in</strong>e cells <strong>in</strong> response to <strong>Candida</strong> <strong>albicans</strong> yeasts and hyphae" by Gil and Gozalbo, Microbes and Infection 8 (2006) 2823-2824. Microbes Infect, 8, 2821-2822; author reply 2823-2824. 112. Nikawa, H., Nishimura, H., Hamada, T. and Sadamori, S. (1997) Quantification of thigmotropism (contact sens<strong>in</strong>g) of <strong>Candida</strong> <strong>albicans</strong> and <strong>Candida</strong> tropicalis. Mycopathologia, 138, 13-19. 113. Odds, F. (1994) <strong>Candida</strong> species and virulence. ASM news, Vol. 60, pp. 313-318. 114. Odds, F.C. (1988) <strong>Candida</strong> and Candidosis. Bailliere T<strong>in</strong>dall, London. 115. Okamura, Y., Watari, M., Jerud, E.S., Young, D.W., Ishizaka, S.T., Rose, J., Chow, J.C. and Strauss, J.F., 3rd. (2001) The extra doma<strong>in</strong> A of fibronect<strong>in</strong> activates Toll-like receptor 4. J Biol Chem, 276, 10229-10233. 127
- Seite 1:
Candida albicans-induzierte Genexpr
- Seite 5:
Alles Wissen und alles Vermehren un
- Seite 8 und 9:
2.10 siRNAs (Doppelstrang-Oligonukl
- Seite 10 und 11:
4.3.6 Der C. albicans-induzierten C
- Seite 13 und 14:
1 Einleitung 1.1 Der Hefepilz Candi
- Seite 15 und 16:
1.1.2 Pathogenese und Virulenzfakto
- Seite 17 und 18:
gekennzeichneter Befall der Zunge,
- Seite 19 und 20:
Chemokinen, immunregulatorischen Ob
- Seite 21 und 22:
1.4 Der p38 MAP Kinase-Signalweg Di
- Seite 23 und 24:
PAMPs und deren TLRs spezifischen M
- Seite 25 und 26:
eine Reihe von Autophosphorylierung
- Seite 27:
Mit der vorliegenden Arbeit sollte
- Seite 30 und 31:
6 x Probenpuffer für Agarose-Gelel
- Seite 32 und 33:
2.5 Antikörper 2.5.1 Antikörper f
- Seite 34 und 35:
Dulbecco’s modified Eagle’s Med
- Seite 36 und 37:
2.11 Zellen, Pilze und Bakterien HU
- Seite 39 und 40:
3 Methoden 3.1 Zellkultur Alle Zell
- Seite 41 und 42:
3.1.2.4 ΦNX ampho und FLYRD-18 Die
- Seite 43 und 44:
3.2.1 Retrovirale Infektion von HUV
- Seite 45 und 46:
94 µl OptiMEM) versetzt. Beide Lö
- Seite 47 und 48:
Abbildung 3.2 Darstellung der Oligo
- Seite 49 und 50:
VCAM-1 ACATGGAATTCGAACCCAAACA GGCTG
- Seite 51 und 52:
3.6.2 Proteintransfer Für den immu
- Seite 53 und 54:
wurden die stimulierten Zellen mit
- Seite 55 und 56:
Kontrollen gemessen. Dafür wurden
- Seite 57 und 58:
3.11.6 Konzentrationsbestimmung von
- Seite 59 und 60:
Klonierung: Für die vorliegende Ar
- Seite 61 und 62:
4 Ergebnisse 4.1 Etablierung eines
- Seite 63 und 64:
Für weitere Versuche wurde, soweit
- Seite 65 und 66:
der Co-Kultur letztendlich zum Zell
- Seite 67 und 68:
Hitze-Inaktivierung auf einer Sabou
- Seite 69 und 70:
4.2 Untersuchung des C. albicans-in
- Seite 71 und 72:
waren Gene, die im Zusammenhang mit
- Seite 73 und 74:
IκBα-Phosphorylierung innerhalb v
- Seite 75 und 76:
Selektion war die geforderte Mindes
- Seite 77 und 78:
4.3.4 Die C. albicans-induzierte Ex
- Seite 79 und 80:
4.3.5 Die C. albicans-induzierte Ex
- Seite 81 und 82:
Hypothese eines indirekten Mechanis
- Seite 83 und 84:
4.4 C. albicans aktiviert die p38 M
- Seite 85 und 86:
Abbildung 4.21 Die C. albicans-indu
- Seite 87 und 88: CXCL8-Synthese und die κB-kontroll
- Seite 89 und 90: HEK293-Zelllinien jeweils mit spezi
- Seite 91 und 92: transfizierten Zellen kaum beeinflu
- Seite 93 und 94: Abbildung 4.28 Eine shRNA gegen IRA
- Seite 95 und 96: unterschiedlicher Antikörper im We
- Seite 97 und 98: Die deutliche Abhängigkeit der C.
- Seite 99 und 100: Abbildung 4.33 Die Poly(I:C)-induzi
- Seite 101 und 102: 5 Diskussion Die Interaktion von hu
- Seite 103 und 104: Bedingungen in HUVEC herunterreguli
- Seite 105 und 106: subendotheliale glatte Muskelzellen
- Seite 107 und 108: Ausgehend von diesem Ergebnis konnt
- Seite 109 und 110: stress-aktivierte Protein-1 Kinase
- Seite 111 und 112: N-verknüpfte Mannosylreste an den
- Seite 113 und 114: dominant-negativen Mutanten beider
- Seite 115 und 116: 5.7 Ausblick In dieser Arbeit konnt
- Seite 117 und 118: 6 Anhang 6.1 Endotheliale Gene, die
- Seite 119 und 120: 212803_at Zhangfei NGFI-A binding p
- Seite 121 und 122: 221795_at neurotrophic tyrosine kin
- Seite 123 und 124: 217683_at hemoglobin, epsilon 1 2.6
- Seite 125 und 126: 7 Zusammenfassung Endothelzellen si
- Seite 127 und 128: 8 Summary Endothelial cells (ECs) a
- Seite 129 und 130: 9 Literatur 1. Abbas, A.K. (2005) C
- Seite 131 und 132: lectin DC-SIGN (CD209) is an antige
- Seite 133 und 134: 44. Ghannoum, M.A., Swairjo, I. and
- Seite 135 und 136: interleukin-8 synthesis integrates
- Seite 137: 84. Langeggen, H., Namork, E., John
- Seite 141 und 142: albicans Invasin That Binds to Cadh
- Seite 143 und 144: 147. Slutsky, B., Staebell, M., And
- Seite 145 und 146: aid in diagnosing systemic candidia
- Seite 147 und 148: involves degradation of IkappaBalph
- Seite 149 und 150: 10 Abkürzungen M molar mA Milliamp
- Seite 151 und 152: 11 Danksagung Die vorliegende Arbei
- Seite 153 und 154: 12 Lebenslauf Persönliche Daten Vo
- Seite 155 und 156: 13 Publikationsliste 13.1 Publikati
- Seite 157: 14 Erklärung Hiermit erkläre ich