176. Wispl<strong>in</strong>ghoff, H., Bischoff, T., Tallent, S.M., Seifert, H., Wenzel, R.P. and Edmond, M.B. (2004) Nosocomial bloodstream <strong>in</strong>fections <strong>in</strong> US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Cl<strong>in</strong> Infect Dis, 39, 309-317. 177. Wu, G.D., Lai, E.J., Huang, N. and Wen, X. (1997) Oct-1 and CCAAT/enhancer-b<strong>in</strong>d<strong>in</strong>g prote<strong>in</strong> (C/EBP) b<strong>in</strong>d to overlapp<strong>in</strong>g elements with<strong>in</strong> the <strong>in</strong>terleuk<strong>in</strong>-8 promoter. The role of Oct-1 as a transcriptional repressor. J Biol Chem, 272, 2396-2403. 178. Wyllie, D.H., Kiss-Toth, E., Vis<strong>in</strong>t<strong>in</strong>, A., Smith, S.C., Boussouf, S., Segal, D.M., Duff, G.W. and Dower, S.K. (2000) Evidence for an accessory prote<strong>in</strong> function for Toll-like receptor 1 <strong>in</strong> anti-bacterial responses. J Immunol, 165, 7125-7132. 179. Yamamoto, M., Sato, S., Hemmi, H., Hosh<strong>in</strong>o, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K. and Akira, S. (2003) Role of adaptor TRIF <strong>in</strong> the MyD88-<strong>in</strong>dependent toll-like receptor signal<strong>in</strong>g pathway. Science, 301, 640-643. 180. Yamaoka, S., Courtois, G., Bessia, C., Whiteside, S.T., Weil, R., Agou, F., Kirk, H.E., Kay, R.J. and Israel, A. (1998) Complementation clon<strong>in</strong>g of NEMO, a component of the IkappaB k<strong>in</strong>ase complex essential for NF-kappaB activation. Cell, 93, 1231-1240. 181. Yan, S.R., Joseph, R.R., Wang, J. and Stadnyk, A.W. (2006) Differential pattern of <strong>in</strong>flammatory molecule regulation <strong>in</strong> <strong>in</strong>test<strong>in</strong>al epithelial cells stimulated with IL-1. J Immunol, 177, 5604-5611. 182. Yang, D., Chen, Q., Hoover, D.M., Staley, P., Tucker, K.D., Lubkowski, J. and Oppenheim, J.J. (2003) Many chemok<strong>in</strong>es <strong>in</strong>clud<strong>in</strong>g CCL20/MIP- 3alpha display antimicrobial activity. J Leukoc Biol, 74, 448-455. 183. Yang, R.B., Mark, M.R., Gray, A., Huang, A., Xie, M.H., Zhang, M., Goddard, A., Wood, W.I., Gurney, A.L. and Godowski, P.J. (1998) Toll-like receptor-2 mediates lipopolysaccharide-<strong>in</strong>duced cellular signall<strong>in</strong>g. Nature, 395, 284-288. 184. Zen, K., Karsan, A., Eunson, T., Yee, E. and Harlan, J.M. (1998) Lipopolysaccharide-<strong>in</strong>duced NF-kappaB activation <strong>in</strong> human endothelial cells 134
<strong>in</strong>volves degradation of IkappaBalpha but not IkappaBbeta. Exp Cell Res, 243, 425-433. 185. Zeuke, S., Ulmer, A.J., Kusumoto, S., Katus, H.A. and He<strong>in</strong>e, H. (2002) TLR4-mediated <strong>in</strong>flammatory activation of human coronary artery endothelial cells by LPS. Cardiovasc Res, 56, 126-134. 135
- Seite 1:
Candida albicans-induzierte Genexpr
- Seite 5:
Alles Wissen und alles Vermehren un
- Seite 8 und 9:
2.10 siRNAs (Doppelstrang-Oligonukl
- Seite 10 und 11:
4.3.6 Der C. albicans-induzierten C
- Seite 13 und 14:
1 Einleitung 1.1 Der Hefepilz Candi
- Seite 15 und 16:
1.1.2 Pathogenese und Virulenzfakto
- Seite 17 und 18:
gekennzeichneter Befall der Zunge,
- Seite 19 und 20:
Chemokinen, immunregulatorischen Ob
- Seite 21 und 22:
1.4 Der p38 MAP Kinase-Signalweg Di
- Seite 23 und 24:
PAMPs und deren TLRs spezifischen M
- Seite 25 und 26:
eine Reihe von Autophosphorylierung
- Seite 27:
Mit der vorliegenden Arbeit sollte
- Seite 30 und 31:
6 x Probenpuffer für Agarose-Gelel
- Seite 32 und 33:
2.5 Antikörper 2.5.1 Antikörper f
- Seite 34 und 35:
Dulbecco’s modified Eagle’s Med
- Seite 36 und 37:
2.11 Zellen, Pilze und Bakterien HU
- Seite 39 und 40:
3 Methoden 3.1 Zellkultur Alle Zell
- Seite 41 und 42:
3.1.2.4 ΦNX ampho und FLYRD-18 Die
- Seite 43 und 44:
3.2.1 Retrovirale Infektion von HUV
- Seite 45 und 46:
94 µl OptiMEM) versetzt. Beide Lö
- Seite 47 und 48:
Abbildung 3.2 Darstellung der Oligo
- Seite 49 und 50:
VCAM-1 ACATGGAATTCGAACCCAAACA GGCTG
- Seite 51 und 52:
3.6.2 Proteintransfer Für den immu
- Seite 53 und 54:
wurden die stimulierten Zellen mit
- Seite 55 und 56:
Kontrollen gemessen. Dafür wurden
- Seite 57 und 58:
3.11.6 Konzentrationsbestimmung von
- Seite 59 und 60:
Klonierung: Für die vorliegende Ar
- Seite 61 und 62:
4 Ergebnisse 4.1 Etablierung eines
- Seite 63 und 64:
Für weitere Versuche wurde, soweit
- Seite 65 und 66:
der Co-Kultur letztendlich zum Zell
- Seite 67 und 68:
Hitze-Inaktivierung auf einer Sabou
- Seite 69 und 70:
4.2 Untersuchung des C. albicans-in
- Seite 71 und 72:
waren Gene, die im Zusammenhang mit
- Seite 73 und 74:
IκBα-Phosphorylierung innerhalb v
- Seite 75 und 76:
Selektion war die geforderte Mindes
- Seite 77 und 78:
4.3.4 Die C. albicans-induzierte Ex
- Seite 79 und 80:
4.3.5 Die C. albicans-induzierte Ex
- Seite 81 und 82:
Hypothese eines indirekten Mechanis
- Seite 83 und 84:
4.4 C. albicans aktiviert die p38 M
- Seite 85 und 86:
Abbildung 4.21 Die C. albicans-indu
- Seite 87 und 88:
CXCL8-Synthese und die κB-kontroll
- Seite 89 und 90:
HEK293-Zelllinien jeweils mit spezi
- Seite 91 und 92:
transfizierten Zellen kaum beeinflu
- Seite 93 und 94:
Abbildung 4.28 Eine shRNA gegen IRA
- Seite 95 und 96: unterschiedlicher Antikörper im We
- Seite 97 und 98: Die deutliche Abhängigkeit der C.
- Seite 99 und 100: Abbildung 4.33 Die Poly(I:C)-induzi
- Seite 101 und 102: 5 Diskussion Die Interaktion von hu
- Seite 103 und 104: Bedingungen in HUVEC herunterreguli
- Seite 105 und 106: subendotheliale glatte Muskelzellen
- Seite 107 und 108: Ausgehend von diesem Ergebnis konnt
- Seite 109 und 110: stress-aktivierte Protein-1 Kinase
- Seite 111 und 112: N-verknüpfte Mannosylreste an den
- Seite 113 und 114: dominant-negativen Mutanten beider
- Seite 115 und 116: 5.7 Ausblick In dieser Arbeit konnt
- Seite 117 und 118: 6 Anhang 6.1 Endotheliale Gene, die
- Seite 119 und 120: 212803_at Zhangfei NGFI-A binding p
- Seite 121 und 122: 221795_at neurotrophic tyrosine kin
- Seite 123 und 124: 217683_at hemoglobin, epsilon 1 2.6
- Seite 125 und 126: 7 Zusammenfassung Endothelzellen si
- Seite 127 und 128: 8 Summary Endothelial cells (ECs) a
- Seite 129 und 130: 9 Literatur 1. Abbas, A.K. (2005) C
- Seite 131 und 132: lectin DC-SIGN (CD209) is an antige
- Seite 133 und 134: 44. Ghannoum, M.A., Swairjo, I. and
- Seite 135 und 136: interleukin-8 synthesis integrates
- Seite 137 und 138: 84. Langeggen, H., Namork, E., John
- Seite 139 und 140: MacCallum, D.M., Odds, F.C., Van de
- Seite 141 und 142: albicans Invasin That Binds to Cadh
- Seite 143 und 144: 147. Slutsky, B., Staebell, M., And
- Seite 145: aid in diagnosing systemic candidia
- Seite 149 und 150: 10 Abkürzungen M molar mA Milliamp
- Seite 151 und 152: 11 Danksagung Die vorliegende Arbei
- Seite 153 und 154: 12 Lebenslauf Persönliche Daten Vo
- Seite 155 und 156: 13 Publikationsliste 13.1 Publikati
- Seite 157: 14 Erklärung Hiermit erkläre ich
Change language