116. Olivier, S., Robe, P. and Bours, V. (2006) Can NF-kappaB be a target for novel and efficient anti-cancer agents? Biochem Pharmacol, 72, 1054- 1068. 117. Orozco, A.S., Zhou, X. and Filler, S.G. (2000) Mechanisms of the pro<strong>in</strong>flammatory response of endothelial cells to <strong>Candida</strong> <strong>albicans</strong> <strong>in</strong>fection. Infect Immun, 68, 1134-1141. 118. Otkjaer, K., Kragballe, K., Johansen, C., Fund<strong>in</strong>g, A.T., Just, H., Jensen, U.B., Sorensen, L.G., Norby, P.L., Clausen, J.T. and Iversen, L. (2007) IL-20 Gene Expression Is Induced by IL-1beta through Mitogen- Activated Prote<strong>in</strong> K<strong>in</strong>ase and NF-kappaB-Dependent Mechanisms. J Invest Dermatol. 119. Oz<strong>in</strong>sky, A., Underhill, D.M., Fontenot, J.D., Hajjar, A.M., Smith, K.D., Wilson, C.B., Schroeder, L. and Aderem, A. (2000) The repertoire for pattern recognition of pathogens by the <strong>in</strong>nate immune system is def<strong>in</strong>ed by cooperation between toll-like receptors. Proc Natl Acad Sci U S A, 97, 13766- 13771. 120. Pahl, H.L. (1999) Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene, 18, 6853-6866. 121. Palsson-McDermott, E.M. and O'Neill, L.A. (2004) Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology, 113, 153-162. 122. Peifer, C., Wagner, G. and Laufer, S. (2006) New approaches to the treatment of <strong>in</strong>flammatory disorders small molecule <strong>in</strong>hibitors of p38 MAP k<strong>in</strong>ase. Curr Top Med Chem, 6, 113-149. 123. Phan, Q.T., Belanger, P.H. and Filler, S.G. (2000) Role of hyphal formation <strong>in</strong> <strong>in</strong>teractions of <strong>Candida</strong> <strong>albicans</strong> with endothelial cells. Infect Immun, 68, 3485-3490. 124. Phan, Q.T., Fratti, R.A., Prasadarao, N.V., Edwards, J.E., Jr. and Filler, S.G. (2005) N-cadher<strong>in</strong> mediates endocytosis of <strong>Candida</strong> <strong>albicans</strong> by endothelial cells. J Biol Chem, 280, 10455-10461. 125. Phan, Q.T., Myers, C.L., Fu, Y., Sheppard, D.C., Yeaman, M.R., Welch, W.H., Ibrahim, A.S., Edwards, J.E. and Filler, S.G. (2007) Als3 Is a <strong>Candida</strong> 128
<strong>albicans</strong> Invas<strong>in</strong> That B<strong>in</strong>ds to Cadher<strong>in</strong>s and Induces Endocytosis by Host Cells. PLoS Biol, 5, e64. 126. Pivarcsi, A., Kemeny, L. and Dobozy, A. (2004) Innate immune functions of the kerat<strong>in</strong>ocytes. A review. Acta Microbiol Immunol Hung, 51, 303-310. 127. Pober, J.S. and Cotran, R.S. (1990) The role of endothelial cells <strong>in</strong> <strong>in</strong>flammation. Transplantation, 50, 537-544. 128. Poltorak, A., He, X., Smirnova, I., Liu, M.Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi- Castagnoli, P., Layton, B. and Beutler, B. (1998) Defective LPS signal<strong>in</strong>g <strong>in</strong> C3H/HeJ and C57BL/10ScCr mice: mutations <strong>in</strong> Tlr4 gene. Science, 282, 2085-2088. 129. Qureshi, S.T., Lariviere, L., Leveque, G., Clermont, S., Moore, K.J., Gros, P. and Malo, D. (1999) Endotox<strong>in</strong>-tolerant mice have mutations <strong>in</strong> Tolllike receptor 4 (Tlr4). J Exp Med, 189, 615-625. 130. Rajeevan, M.S., Ranamukhaarachchi, D.G., Vernon, S.D. and Unger, E.R. (2001) Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods, 25, 443-451. 131. Raman, T. and Marik, P.E. (2006) Fungal <strong>in</strong>fections <strong>in</strong> bone marrow transplant recipients. Expert Op<strong>in</strong> Pharmacother, 7, 307-315. 132. Ridley, S.H., Sarsfield, S.J., Lee, J.C., Bigg, H.F., Cawston, T.E., Taylor, D.J., DeWitt, D.L. and Saklatvala, J. (1997) Actions of IL-1 are selectively controlled by p38 mitogen-activated prote<strong>in</strong> k<strong>in</strong>ase: regulation of prostagland<strong>in</strong> H synthase-2, metalloprote<strong>in</strong>ases, and IL-6 at different levels. J Immunol, 158, 3165-3173. 133. Roeder, A., Kirschn<strong>in</strong>g, C.J., Rupec, R.A., Schaller, M. and Kort<strong>in</strong>g, H.C. (2004a) Toll-like receptors and <strong>in</strong>nate antifungal responses. Trends Microbiol, 12, 44-49. 134. Roeder, A., Kirschn<strong>in</strong>g, C.J., Rupec, R.A., Schaller, M., We<strong>in</strong>dl, G. and Kort<strong>in</strong>g, H.C. (2004b) Toll-like receptors as key mediators <strong>in</strong> <strong>in</strong>nate antifungal immunity. Med Mycol, 42, 485-498. 135. Rostand, K.S. and Esko, J.D. (1997) Microbial adherence to and <strong>in</strong>vasion through proteoglycans. Infect Immun, 65, 1-8. 129
- Seite 1:
Candida albicans-induzierte Genexpr
- Seite 5:
Alles Wissen und alles Vermehren un
- Seite 8 und 9:
2.10 siRNAs (Doppelstrang-Oligonukl
- Seite 10 und 11:
4.3.6 Der C. albicans-induzierten C
- Seite 13 und 14:
1 Einleitung 1.1 Der Hefepilz Candi
- Seite 15 und 16:
1.1.2 Pathogenese und Virulenzfakto
- Seite 17 und 18:
gekennzeichneter Befall der Zunge,
- Seite 19 und 20:
Chemokinen, immunregulatorischen Ob
- Seite 21 und 22:
1.4 Der p38 MAP Kinase-Signalweg Di
- Seite 23 und 24:
PAMPs und deren TLRs spezifischen M
- Seite 25 und 26:
eine Reihe von Autophosphorylierung
- Seite 27:
Mit der vorliegenden Arbeit sollte
- Seite 30 und 31:
6 x Probenpuffer für Agarose-Gelel
- Seite 32 und 33:
2.5 Antikörper 2.5.1 Antikörper f
- Seite 34 und 35:
Dulbecco’s modified Eagle’s Med
- Seite 36 und 37:
2.11 Zellen, Pilze und Bakterien HU
- Seite 39 und 40:
3 Methoden 3.1 Zellkultur Alle Zell
- Seite 41 und 42:
3.1.2.4 ΦNX ampho und FLYRD-18 Die
- Seite 43 und 44:
3.2.1 Retrovirale Infektion von HUV
- Seite 45 und 46:
94 µl OptiMEM) versetzt. Beide Lö
- Seite 47 und 48:
Abbildung 3.2 Darstellung der Oligo
- Seite 49 und 50:
VCAM-1 ACATGGAATTCGAACCCAAACA GGCTG
- Seite 51 und 52:
3.6.2 Proteintransfer Für den immu
- Seite 53 und 54:
wurden die stimulierten Zellen mit
- Seite 55 und 56:
Kontrollen gemessen. Dafür wurden
- Seite 57 und 58:
3.11.6 Konzentrationsbestimmung von
- Seite 59 und 60:
Klonierung: Für die vorliegende Ar
- Seite 61 und 62:
4 Ergebnisse 4.1 Etablierung eines
- Seite 63 und 64:
Für weitere Versuche wurde, soweit
- Seite 65 und 66:
der Co-Kultur letztendlich zum Zell
- Seite 67 und 68:
Hitze-Inaktivierung auf einer Sabou
- Seite 69 und 70:
4.2 Untersuchung des C. albicans-in
- Seite 71 und 72:
waren Gene, die im Zusammenhang mit
- Seite 73 und 74:
IκBα-Phosphorylierung innerhalb v
- Seite 75 und 76:
Selektion war die geforderte Mindes
- Seite 77 und 78:
4.3.4 Die C. albicans-induzierte Ex
- Seite 79 und 80:
4.3.5 Die C. albicans-induzierte Ex
- Seite 81 und 82:
Hypothese eines indirekten Mechanis
- Seite 83 und 84:
4.4 C. albicans aktiviert die p38 M
- Seite 85 und 86:
Abbildung 4.21 Die C. albicans-indu
- Seite 87 und 88:
CXCL8-Synthese und die κB-kontroll
- Seite 89 und 90: HEK293-Zelllinien jeweils mit spezi
- Seite 91 und 92: transfizierten Zellen kaum beeinflu
- Seite 93 und 94: Abbildung 4.28 Eine shRNA gegen IRA
- Seite 95 und 96: unterschiedlicher Antikörper im We
- Seite 97 und 98: Die deutliche Abhängigkeit der C.
- Seite 99 und 100: Abbildung 4.33 Die Poly(I:C)-induzi
- Seite 101 und 102: 5 Diskussion Die Interaktion von hu
- Seite 103 und 104: Bedingungen in HUVEC herunterreguli
- Seite 105 und 106: subendotheliale glatte Muskelzellen
- Seite 107 und 108: Ausgehend von diesem Ergebnis konnt
- Seite 109 und 110: stress-aktivierte Protein-1 Kinase
- Seite 111 und 112: N-verknüpfte Mannosylreste an den
- Seite 113 und 114: dominant-negativen Mutanten beider
- Seite 115 und 116: 5.7 Ausblick In dieser Arbeit konnt
- Seite 117 und 118: 6 Anhang 6.1 Endotheliale Gene, die
- Seite 119 und 120: 212803_at Zhangfei NGFI-A binding p
- Seite 121 und 122: 221795_at neurotrophic tyrosine kin
- Seite 123 und 124: 217683_at hemoglobin, epsilon 1 2.6
- Seite 125 und 126: 7 Zusammenfassung Endothelzellen si
- Seite 127 und 128: 8 Summary Endothelial cells (ECs) a
- Seite 129 und 130: 9 Literatur 1. Abbas, A.K. (2005) C
- Seite 131 und 132: lectin DC-SIGN (CD209) is an antige
- Seite 133 und 134: 44. Ghannoum, M.A., Swairjo, I. and
- Seite 135 und 136: interleukin-8 synthesis integrates
- Seite 137 und 138: 84. Langeggen, H., Namork, E., John
- Seite 139: MacCallum, D.M., Odds, F.C., Van de
- Seite 143 und 144: 147. Slutsky, B., Staebell, M., And
- Seite 145 und 146: aid in diagnosing systemic candidia
- Seite 147 und 148: involves degradation of IkappaBalph
- Seite 149 und 150: 10 Abkürzungen M molar mA Milliamp
- Seite 151 und 152: 11 Danksagung Die vorliegende Arbei
- Seite 153 und 154: 12 Lebenslauf Persönliche Daten Vo
- Seite 155 und 156: 13 Publikationsliste 13.1 Publikati
- Seite 157: 14 Erklärung Hiermit erkläre ich