contribution of the Toll-like/IL-1 receptor superfamily to <strong>in</strong>nate and adaptive immunity to fungal pathogens <strong>in</strong> vivo. J Immunol, 172, 3059-3069. 13. Betts, R., Glasmacher, A., Maertens, J., Maschmeyer, G., Vazquez, J.A., Teppler, H., Taylor, A., Lup<strong>in</strong>acci, R., Sable, C. and Kartsonis, N. (2006) Efficacy of caspofung<strong>in</strong> aga<strong>in</strong>st <strong>in</strong>vasive <strong>Candida</strong> or <strong>in</strong>vasive Aspergillus <strong>in</strong>fections <strong>in</strong> neutropenic patients. Cancer, 106, 466-473. 14. Birnboim, H.C. and Doly, J. (1979) A rapid alkal<strong>in</strong>e extraction procedure for screen<strong>in</strong>g recomb<strong>in</strong>ant plasmid DNA. Nucleic Acids Res, 7, 1513-1523. 15. Brentano, F., Schorr, O., Gay, R.E., Gay, S. and Kyburz, D. (2005) RNA released from necrotic synovial fluid cells activates rheumatoid arthritis synovial fibroblasts via Toll-like receptor 3. Arthritis Rheum, 52, 2656-2665. 16. Brown, G.D., Herre, J., Williams, D.L., Willment, J.A., Marshall, A.S. and Gordon, S. (2003) Dect<strong>in</strong>-1 mediates the biological effects of beta-glucans. J Exp Med, 197, 1119-1124. 17. Brummelkamp, T.R. and Bernards, R. (2003) New tools for functional mammalian cancer genetics. Nat Rev Cancer, 3, 781-789. 18. Brummelkamp, T.R., Bernards, R. and Agami, R. (2002) Stable suppression of tumorigenicity by virus-mediated RNA <strong>in</strong>terference. Cancer Cell, 2, 243-247. 19. Burns, J.M., Summers, B.C., Wang, Y., Melikian, A., Berahovich, R., Miao, Z., Penfold, M.E., Sunsh<strong>in</strong>e, M.J., Littman, D.R., Kuo, C.J., Wei, K., McMaster, B.E., Wright, K., Howard, M.C. and Schall, T.J. (2006) A novel chemok<strong>in</strong>e receptor for SDF-1 and I-TAC <strong>in</strong>volved <strong>in</strong> cell survival, cell adhesion, and tumor development. J Exp Med, 203, 2201-2213. 20. Busse R, F.I. (1993) The endothelial organ. Cardiology, 8, 719-727. 21. Calderone, R., Suzuki, S., Cannon, R., Cho, T., Boyd, D., Calera, J., Chibana, H., Herman, D., Holmes, A., Jeng, H.W., Kam<strong>in</strong>ishi, H., Matsumoto, T., Mikami, T., O'Sullivan, J.M., Sudoh, M., Suzuki, M., Nakashima, Y., Tanaka, T., Tompk<strong>in</strong>s, G.R. and Watanabe, T. (2000) <strong>Candida</strong> <strong>albicans</strong>: adherence, signal<strong>in</strong>g and virulence. Med Mycol, 38 Suppl 1, 125-137. 22. Calderone, R.A. and Fonzi, W.A. (2001) Virulence factors of <strong>Candida</strong> <strong>albicans</strong>. Trends Microbiol, 9, 327-335. 23. Cambi, A., Gijzen, K., de Vries, J.M., Torensma, R., Joosten, B., Adema, G.J., Netea, M.G., Kullberg, B.J., Romani, L. and Figdor, C.G. (2003) The C-type 118
lect<strong>in</strong> DC-SIGN (CD209) is an antigen-uptake receptor for <strong>Candida</strong> <strong>albicans</strong> on dendritic cells. Eur J Immunol, 33, 532-538. 24. Cao, Z., Xiong, J., Takeuchi, M., Kurama, T. and Goeddel, D.V. (1996) TRAF6 is a signal transducer for <strong>in</strong>terleuk<strong>in</strong>-1. Nature, 383, 443-446. 25. Carballo, E., Lai, W.S. and Blackshear, P.J. (1998) Feedback <strong>in</strong>hibition of macrophage tumor necrosis factor-alpha production by tristetraprol<strong>in</strong>. Science, 281, 1001-1005. 26. Castro, M., Bjoraker, J.A., Rohrbach, M.S. and Limper, A.H. (1996) <strong>Candida</strong> <strong>albicans</strong> <strong>in</strong>duces the release of <strong>in</strong>flammatory mediators from human peripheral blood monocytes. Inflammation, 20, 107-122. 27. Chaff<strong>in</strong>, W.L., Lopez-Ribot, J.L., Casanova, M., Gozalbo, D. and Mart<strong>in</strong>ez, J.P. (1998) Cell wall and secreted prote<strong>in</strong>s of <strong>Candida</strong> <strong>albicans</strong>: identification, function, and expression. Microbiol Mol Biol Rev, 62, 130-180. 28. Chang, L. and Kar<strong>in</strong>, M. (2001) Mammalian MAP k<strong>in</strong>ase signall<strong>in</strong>g cascades. Nature, 410, 37-40. 29. Cole, G.T., Halawa, A.A. and Anaissie, E.J. (1996) The role of the gastro<strong>in</strong>test<strong>in</strong>al tract <strong>in</strong> hematogenous candidiasis: from the laboratory to the bedside. Cl<strong>in</strong> Infect Dis, 22 Suppl 2, S73-88. 30. Cosset, F.L., Takeuchi, Y., Batt<strong>in</strong>i, J.L., Weiss, R.A. and Coll<strong>in</strong>s, M.K. (1995) High-titer packag<strong>in</strong>g cells produc<strong>in</strong>g recomb<strong>in</strong>ant retroviruses resistant to human serum. J Virol, 69, 7430-7436. 31. Denk, A., Goebeler, M., Schmid, S., Berberich, I., Ritz, O., L<strong>in</strong>demann, D., Ludwig, S. and Wirth, T. (2001) Activation of NF-kappa B via the Ikappa B k<strong>in</strong>ase complex is both essential and sufficient for pro<strong>in</strong>flammatory gene expression <strong>in</strong> primary endothelial cells. J Biol Chem, 276, 28451-28458. 32. Denn<strong>in</strong>g, D.W. (2003) Ech<strong>in</strong>ocand<strong>in</strong> antifungal drugs. Lancet, 362, 1142-1151. 33. Deva, R., Shankaranarayanan, P., Ciccoli, R. and Nigam, S. (2003) <strong>Candida</strong> <strong>albicans</strong> <strong>in</strong>duces selectively transcriptional activation of cyclooxygenase-2 <strong>in</strong> HeLa cells: pivotal roles of Toll-like receptors, p38 mitogen-activated prote<strong>in</strong> k<strong>in</strong>ase, and NF-kappa B. J Immunol, 171, 3047-3055. 34. Dieu-Nosjean, M.C., Massacrier, C., Homey, B., Vanbervliet, B., P<strong>in</strong>, J.J., Vicari, A., Lebecque, S., Dezutter-Dambuyant, C., Schmitt, D., Zlotnik, A. and Caux, C. (2000) Macrophage <strong>in</strong>flammatory prote<strong>in</strong> 3alpha is expressed at 119
- Seite 1:
Candida albicans-induzierte Genexpr
- Seite 5:
Alles Wissen und alles Vermehren un
- Seite 8 und 9:
2.10 siRNAs (Doppelstrang-Oligonukl
- Seite 10 und 11:
4.3.6 Der C. albicans-induzierten C
- Seite 13 und 14:
1 Einleitung 1.1 Der Hefepilz Candi
- Seite 15 und 16:
1.1.2 Pathogenese und Virulenzfakto
- Seite 17 und 18:
gekennzeichneter Befall der Zunge,
- Seite 19 und 20:
Chemokinen, immunregulatorischen Ob
- Seite 21 und 22:
1.4 Der p38 MAP Kinase-Signalweg Di
- Seite 23 und 24:
PAMPs und deren TLRs spezifischen M
- Seite 25 und 26:
eine Reihe von Autophosphorylierung
- Seite 27:
Mit der vorliegenden Arbeit sollte
- Seite 30 und 31:
6 x Probenpuffer für Agarose-Gelel
- Seite 32 und 33:
2.5 Antikörper 2.5.1 Antikörper f
- Seite 34 und 35:
Dulbecco’s modified Eagle’s Med
- Seite 36 und 37:
2.11 Zellen, Pilze und Bakterien HU
- Seite 39 und 40:
3 Methoden 3.1 Zellkultur Alle Zell
- Seite 41 und 42:
3.1.2.4 ΦNX ampho und FLYRD-18 Die
- Seite 43 und 44:
3.2.1 Retrovirale Infektion von HUV
- Seite 45 und 46:
94 µl OptiMEM) versetzt. Beide Lö
- Seite 47 und 48:
Abbildung 3.2 Darstellung der Oligo
- Seite 49 und 50:
VCAM-1 ACATGGAATTCGAACCCAAACA GGCTG
- Seite 51 und 52:
3.6.2 Proteintransfer Für den immu
- Seite 53 und 54:
wurden die stimulierten Zellen mit
- Seite 55 und 56:
Kontrollen gemessen. Dafür wurden
- Seite 57 und 58:
3.11.6 Konzentrationsbestimmung von
- Seite 59 und 60:
Klonierung: Für die vorliegende Ar
- Seite 61 und 62:
4 Ergebnisse 4.1 Etablierung eines
- Seite 63 und 64:
Für weitere Versuche wurde, soweit
- Seite 65 und 66:
der Co-Kultur letztendlich zum Zell
- Seite 67 und 68:
Hitze-Inaktivierung auf einer Sabou
- Seite 69 und 70:
4.2 Untersuchung des C. albicans-in
- Seite 71 und 72:
waren Gene, die im Zusammenhang mit
- Seite 73 und 74:
IκBα-Phosphorylierung innerhalb v
- Seite 75 und 76:
Selektion war die geforderte Mindes
- Seite 77 und 78:
4.3.4 Die C. albicans-induzierte Ex
- Seite 79 und 80: 4.3.5 Die C. albicans-induzierte Ex
- Seite 81 und 82: Hypothese eines indirekten Mechanis
- Seite 83 und 84: 4.4 C. albicans aktiviert die p38 M
- Seite 85 und 86: Abbildung 4.21 Die C. albicans-indu
- Seite 87 und 88: CXCL8-Synthese und die κB-kontroll
- Seite 89 und 90: HEK293-Zelllinien jeweils mit spezi
- Seite 91 und 92: transfizierten Zellen kaum beeinflu
- Seite 93 und 94: Abbildung 4.28 Eine shRNA gegen IRA
- Seite 95 und 96: unterschiedlicher Antikörper im We
- Seite 97 und 98: Die deutliche Abhängigkeit der C.
- Seite 99 und 100: Abbildung 4.33 Die Poly(I:C)-induzi
- Seite 101 und 102: 5 Diskussion Die Interaktion von hu
- Seite 103 und 104: Bedingungen in HUVEC herunterreguli
- Seite 105 und 106: subendotheliale glatte Muskelzellen
- Seite 107 und 108: Ausgehend von diesem Ergebnis konnt
- Seite 109 und 110: stress-aktivierte Protein-1 Kinase
- Seite 111 und 112: N-verknüpfte Mannosylreste an den
- Seite 113 und 114: dominant-negativen Mutanten beider
- Seite 115 und 116: 5.7 Ausblick In dieser Arbeit konnt
- Seite 117 und 118: 6 Anhang 6.1 Endotheliale Gene, die
- Seite 119 und 120: 212803_at Zhangfei NGFI-A binding p
- Seite 121 und 122: 221795_at neurotrophic tyrosine kin
- Seite 123 und 124: 217683_at hemoglobin, epsilon 1 2.6
- Seite 125 und 126: 7 Zusammenfassung Endothelzellen si
- Seite 127 und 128: 8 Summary Endothelial cells (ECs) a
- Seite 129: 9 Literatur 1. Abbas, A.K. (2005) C
- Seite 133 und 134: 44. Ghannoum, M.A., Swairjo, I. and
- Seite 135 und 136: interleukin-8 synthesis integrates
- Seite 137 und 138: 84. Langeggen, H., Namork, E., John
- Seite 139 und 140: MacCallum, D.M., Odds, F.C., Van de
- Seite 141 und 142: albicans Invasin That Binds to Cadh
- Seite 143 und 144: 147. Slutsky, B., Staebell, M., And
- Seite 145 und 146: aid in diagnosing systemic candidia
- Seite 147 und 148: involves degradation of IkappaBalph
- Seite 149 und 150: 10 Abkürzungen M molar mA Milliamp
- Seite 151 und 152: 11 Danksagung Die vorliegende Arbei
- Seite 153 und 154: 12 Lebenslauf Persönliche Daten Vo
- Seite 155 und 156: 13 Publikationsliste 13.1 Publikati
- Seite 157: 14 Erklärung Hiermit erkläre ich