Tesis Doctoral expression and isoform variation analysis using Affymetrix Exon Arrays. BMC Genomics 9, 529. Benjamini, Y., Drai, D., Elmer, G., Kafkafi, N., and Golani, I. (2001). Controlling the false discovery rate in behavior genetics research. Behav Brain Res 125, 279-‐284. Benson, D.A., Karsch-‐Mizrachi, I., Lipman, D.J., Ostell, J., and Sayers, E.W. (2010). GenBank. Nucleic Acids Res 38, D46-‐51. Bergsagel, P.L., and Kuehl, W.M. (2005). Molecular pathogenesis and a consequent classification of multiple myeloma. J Clin Oncol 23, 6333-‐6338. Bolstad, B.M., Irizarry, R.A., Astrand, M., and Speed, T.P. (2003). A comparison of normalization methods for high <strong>de</strong>nsity oligonucleoti<strong>de</strong> array data based on variance and bias. Bioinformatics 19, 185-‐193. Bushati, N., and Cohen, S.M. (2007). microRNA Functions. Annu Rev Cell Dev Biol 23, 175-‐205. Butte, A.J., Dzau, V.J., and Glueck, S.B. (2001). Further <strong>de</strong>fining housekeeping, or "maintenance," genes Focus on "A compendium of gene expression in normal human tissues". Physiol Genomics 7, 95-‐96. Calin, G.A., and Croce, C.M. (2006). MicroRNA signatures in human cancers. Nat Rev Cancer 6, 857-‐866. Calza, S., Raffelsberger, W., Ploner, A., Sahel, J., Leveillard, T., and Pawitan, Y. (2007). Filtering genes to improve sensitivity in oligonucleoti<strong>de</strong> microarray data analysis. Nucleic Acids Res 35, e102. Carninci, P., Kasukawa, T., Katayama, S., Gough, J., Frith, M.C., Maeda, N., Oyama, R., Ravasi, T., Lenhard, B., Wells, C., et al. (2005). The transcriptional landscape of the mammalian genome. Science 309, 1559-‐1563. Catovsky, D., Richards, S., Matutes, E., Oscier, D., Dyer, M.J., Bezares, R.F., Pettitt, A.R., Hamblin, T., Milligan, D.W., Child, J.A., et al. (2007). Assessment of fludarabine plus cyclophosphami<strong>de</strong> for patients with chronic lymphocytic leukaemia (the LRF CLL4 Trial): a randomised controlled trial. Lancet 370, 230-‐239. Clark, T.A., Schweitzer, A.C., Chen, T.X., Staples, M.K., Lu, G., Wang, H., Williams, A., and Blume, J.E. (2007). Discovery of tissue-‐specific exons using comprehensive human exon microarrays. Genome Biology 8, R64. Cline, M.S., Blume, J., Cawley, S., Clark, T.A., Hu, J.S., Lu, G., Salomonis, N., Wang, H., and Williams, A. (2005). ANOSVA: a statistical method for <strong>de</strong>tecting splice variation from expression data. Bioinformatics 21 Suppl 1, i107-‐115. Coomans, D., and Massart, D.L. (1982). Alternative k-‐nearest neighbour rules in supervised pattern recognition. Analytica Chimica Acta 136, 15-‐27. Cover, T., and Hart, P. (1967). Nearest neighbor pattern classification. IEEE Transactions on Information Theory 13, 21-‐27. Croce, C.M. (2008). Oncogenes and cancer. N Engl J Med 358, 502-‐511. 106
Referencias Croce, C.M. (2009). Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 10, 704-‐714. Cui, J., Chen, Y., Chou, W.C., Sun, L., Chen, L., Suo, J., Ni, Z., Zhang, M., Kong, X., Hoffman, L.L., et al. (2011a). An integrated transcriptomic and computational analysis for biomarker i<strong>de</strong>ntification in gastric cancer. Nucleic Acids Res 39, 1197-‐1207. Cui, J., Li, F., Wang, G., Fang, X., Puett, J.D., and Xu, Y. (2011b). Gene-‐expression signatures can distinguish gastric cancer gra<strong>de</strong>s and stages. PLoS One 6, e17819. Cheng, A.M., Byrom, M.W., Shelton, J., and Ford, L.P. (2005). Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res 33, 1290-‐1297. Chng, W.J., Glebov, O., Bergsagel, P.L., and Kuehl, W.M. (2007a). Genetic events in the pathogenesis of multiple myeloma. Best Pract Res Clin Haematol 20, 571-‐596. Chng, W.J., Kumar, S., Vanwier, S., Ahmann, G., Price-‐Troska, T., Hen<strong>de</strong>rson, K., Chung, T.H., Kim, S., Mulligan, G., Bryant, B., et al. (2007b). Molecular dissection of hyperdiploid multiple myeloma by gene expression profiling. Cancer Res 67, 2982-‐2989. D'Haeseleer, P., Liang, S., and Somogyi, R. (2000). Genetic network inference: from co-‐ expression clustering to reverse engineering. Bioinformatics 16, 707-‐726. Dai, M., Wang, P., Boyd, A.D., Kostov, G., Athey, B., Jones, E.G., Bunney, W.E., Myers, R.M., Speed, T.P., Akil, H., et al. (2005). Evolving gene/transcript <strong>de</strong>finitions significantly alter the interpretation of GeneChip data. Nucleic Acids Res 33, e175. Dal Bo, M., Rossi, F.M., Rossi, D., Deambrogi, C., Bertoni, F., Del Giudice, I., Palumbo, G., Nanni, M., Rinaldi, A., Kwee, I., et al. (2011). 13q14 <strong>de</strong>letion size and number of <strong>de</strong>leted cells both influence prognosis in chronic lymphocytic leukemia. Genes Chromosomes Cancer 50, 633-‐ 643. Draghici, S. (2003). Data analysis tools for DNA microarrays (Boca Raton, Fla ; London, Chapman & Hall/CRC). Durinck, S., Bullard, J., Spellman, P.T., and Dudoit, S. (2009). GenomeGraphs: integrated genomic data visualization with R. BMC Bioinformatics 10, 2. Farber, E., and Rubin, H. (1991). Cellular adaptation in the origin and <strong>de</strong>velopment of cancer. Cancer Res 51, 2751-‐2761. French, P.J., Peeters, J., Horsman, S., Duijm, E., Siccama, I., van <strong>de</strong>n Bent, M.J., Lui<strong>de</strong>r, T.M., Kros, J.M., van <strong>de</strong>r Spek, P., and Sillevis Smitt, P.A. (2007). I<strong>de</strong>ntification of differentially regulated splice variants and novel exons in glial brain tumors using exon expression arrays. Cancer Res 67, 5635-‐5642. Friedmann-‐Morvinski, D., Bushong, E.A., Ke, E., Soda, Y., Marumoto, T., Singer, O., Ellisman, M.H., and Verma, I.M. (2012). Dedifferentiation of neurons and astrocytes by oncogenes can induce gliomas in mice. Science 338, 1080-‐1084. Gaidatzis, D., Jacobeit, K., Oakeley, E.J., and Stadler, M.B. (2009). Overestimation of alternative splicing caused by variable probe characteristics in exon arrays. Nucleic Acids Res 107
- Page 1:
Bioinformática aplicada a estudios
- Page 5 and 6:
Índice INTRODUCCIÓN GENERAL .....
- Page 7 and 8:
Introducción general Bioinformáti
- Page 9 and 10:
Figura 2. Proceso de transcripción
- Page 11 and 12:
Introducción general caciones, las
- Page 13 and 14:
Objetivos Introducción general La
- Page 15 and 16:
Capítulo 1 1.1.1. Bases de datos d
- Page 17 and 18:
Capítulo 1 sondas core y su inform
- Page 19 and 20:
caaatgacttgctattattgatggc 225 694 c
- Page 21 and 22:
presentes en el fichero. Capítulo
- Page 23 and 24:
Capítulo 1 Mus musculus MG_U74Av2
- Page 25 and 26:
Capítulo 1 Figura 1.5. Representac
- Page 27 and 28:
Capítulo 1 Paso 2 Descripción: As
- Page 29 and 30:
Capítulo 1 A la hora de escribir e
- Page 31 and 32:
Capítulo 1 en regiones no codifica
- Page 33 and 34:
Capítulo 1 Para optimizar la preci
- Page 35 and 36:
Figura 1.9a. Distribución del núm
- Page 37 and 38:
Capítulo 1 por contraste el númer
- Page 39 and 40:
Capítulo 1 (cromosoma, locus, exon
- Page 41 and 42:
Capítulo 1 figura 1.16). Además d
- Page 43 and 44:
Capítulo 1 exhaustivo en este ámb
- Page 45 and 46:
Capítulo 1 su presentación y deta
- Page 47:
Capítulo 1 adaptación para los mi
- Page 50 and 51:
Tesis Doctoral pueden agrupar en: t
- Page 52 and 53:
Tesis Doctoral enfermedad a través
- Page 54 and 55:
Tesis Doctoral los genes encontrado
- Page 56 and 57:
Tesis Doctoral real (RT-‐PCR).
- Page 58 and 59:
Tesis Doctoral muestras (ver figura
- Page 60 and 61: Tesis Doctoral subtipo fueron: 0.97
- Page 62 and 63: Tesis Doctoral En este trabajo se h
- Page 64 and 65: Tesis Doctoral permitiría, sin dud
- Page 66 and 67: Tesis Doctoral inclusión entre 0 y
- Page 68 and 69: Tesis Doctoral exacto del número d
- Page 70 and 71: Tesis Doctoral Los valores extremos
- Page 72 and 73: Tesis Doctoral dicho, la comparaci
- Page 74 and 75: Tesis Doctoral 70 Figura 3.6. Los d
- Page 76 and 77: Tesis Doctoral 3.8.b). Sin embargo
- Page 78 and 79: Tesis Doctoral Human Exon 1.0. La l
- Page 80 and 81: Tesis Doctoral 76 Figura 3.10. Curv
- Page 82 and 83: Tesis Doctoral 78 Figura 3.10 (cont
- Page 84 and 85: Tesis Doctoral del inicio del ranki
- Page 87 and 88: Capítulo 4 Análisis de coexpresi
- Page 89 and 90: Capítulo 4 los genes y la perspect
- Page 91 and 92: Capítulo 4 Utilizando el set de da
- Page 93 and 94: ENSG00000142541 RPL13A small nucleo
- Page 95 and 96: Capítulo 4 Para encontrar los gene
- Page 97 and 98: Capítulo 4 ENSG00000134287 ARF3 AD
- Page 99 and 100: Capítulo 4 Figura 4.3. Red de coex
- Page 101 and 102: Capítulo 4 Si analizamos los genes
- Page 103 and 104: Capítulo 4 se hizo comparando cont
- Page 105: 4.4. Discusión y posible trabajo f
- Page 108 and 109: Tesis Doctoral exones, y diseñando
- Page 112 and 113: Tesis Doctoral 37, e107. Gardina, P
- Page 114 and 115: Tesis Doctoral and survival in chro
- Page 116 and 117: Tesis Doctoral Roth, R.B., Hevezi,
- Page 118 and 119: Tesis Doctoral Xi, L., Feber, A., G
- Page 121 and 122: Risueño et al. BMC Bioinformatics
- Page 123 and 124: Risueño et al. BMC Bioinformatics
- Page 125 and 126: Risueño et al. BMC Bioinformatics
- Page 127 and 128: Risueño et al. BMC Bioinformatics
- Page 129 and 130: Risueño et al. BMC Bioinformatics
- Page 131 and 132: Risueño et al. BMC Bioinformatics
- Page 133 and 134: ORIGINAL ARTICLE Deregulation of mi
- Page 135 and 136: Targets component of miRecords inte
- Page 137 and 138: log 10 2-ΔCt -2.00 -4.00 -6.00 -8.
- Page 139 and 140: Table 4 Potential microRNA (miRNA)-
- Page 141 and 142: myeloma pathogenesis. Proc Natl Aca
- Page 143 and 144: genetic subtypes of CLL show differ
- Page 145 and 146: Table 2. Cont. Up-regulated Down-re
- Page 147 and 148: 206 underexpressed in the 13q-H gro
- Page 149 and 150: Table 3. Most significant target ge
- Page 151 and 152: Discussion 13q deletion (13q-) is t
- Page 153 and 154: patients with 17p and 11q deletions
- Page 155 and 156: Human Gene Coexpression Landscape:
- Page 157 and 158: The similarity and proximity of the
- Page 159 and 160: As described in Methods we use a co
- Page 161 and 162:
all data points of coexpression pai
- Page 163 and 164:
Table 1. This work (2008) Pathway N
- Page 165 and 166:
In conclusion, the functional consi
- Page 167 and 168:
a total set of 48 microarrays. The
- Page 169 and 170:
original article Annals of Oncology
- Page 171 and 172:
Annals of Oncology original article
- Page 173 and 174:
Annals of Oncology original article
- Page 175 and 176:
Annals of Oncology original article