Alberto Risueño Pérez - Gredos - Universidad de Salamanca

More documents

Recommendations

Info

Tesis Doctoral 76 Figura 3.10. Curvas ROC comparando 5 métodos de detección de splicing alternativo.
Figura 3.10 (continuación). Curvas ROC comparando 5 métodos de detección de splicing alternativo. Capítulo 3 77
Page 1:
Bioinformática aplicada a estudios
Page 5 and 6:
Índice INTRODUCCIÓN GENERAL .....
Page 7 and 8:
Introducción general Bioinformáti
Page 9 and 10:
Figura 2. Proceso de transcripción
Page 11 and 12:
Introducción general caciones, las
Page 13 and 14:
Objetivos Introducción general La
Page 15 and 16:
Capítulo 1 1.1.1. Bases de datos d
Page 17 and 18:
Capítulo 1 sondas core y su inform
Page 19 and 20:
caaatgacttgctattattgatggc 225 694 c
Page 21 and 22:
presentes en el fichero. Capítulo
Page 23 and 24:
Capítulo 1 Mus musculus MG_U74Av2
Page 25 and 26:
Capítulo 1 Figura 1.5. Representac
Page 27 and 28:
Capítulo 1 Paso 2 Descripción: As
Page 29 and 30: Capítulo 1 A la hora de escribir e
Page 31 and 32: Capítulo 1 en regiones no codifica
Page 33 and 34: Capítulo 1 Para optimizar la preci
Page 35 and 36: Figura 1.9a. Distribución del núm
Page 37 and 38: Capítulo 1 por contraste el númer
Page 39 and 40: Capítulo 1 (cromosoma, locus, exon
Page 41 and 42: Capítulo 1 figura 1.16). Además d
Page 43 and 44: Capítulo 1 exhaustivo en este ámb
Page 45 and 46: Capítulo 1 su presentación y deta
Page 47: Capítulo 1 adaptación para los mi
Page 50 and 51: Tesis Doctoral pueden agrupar en: t
Page 52 and 53: Tesis Doctoral enfermedad a través
Page 54 and 55: Tesis Doctoral los genes encontrado
Page 56 and 57: Tesis Doctoral real (RT-‐PCR).
Page 58 and 59: Tesis Doctoral muestras (ver figura
Page 60 and 61: Tesis Doctoral subtipo fueron: 0.97
Page 62 and 63: Tesis Doctoral En este trabajo se h
Page 64 and 65: Tesis Doctoral permitiría, sin dud
Page 66 and 67: Tesis Doctoral inclusión entre 0 y
Page 68 and 69: Tesis Doctoral exacto del número d
Page 70 and 71: Tesis Doctoral Los valores extremos
Page 72 and 73: Tesis Doctoral dicho, la comparaci
Page 74 and 75: Tesis Doctoral 70 Figura 3.6. Los d
Page 76 and 77: Tesis Doctoral 3.8.b). Sin embargo
Page 78 and 79: Tesis Doctoral Human Exon 1.0. La l
Page 82 and 83: Tesis Doctoral 78 Figura 3.10 (cont
Page 84 and 85: Tesis Doctoral del inicio del ranki
Page 87 and 88: Capítulo 4 Análisis de coexpresi
Page 89 and 90: Capítulo 4 los genes y la perspect
Page 91 and 92: Capítulo 4 Utilizando el set de da
Page 93 and 94: ENSG00000142541 RPL13A small nucleo
Page 95 and 96: Capítulo 4 Para encontrar los gene
Page 97 and 98: Capítulo 4 ENSG00000134287 ARF3 AD
Page 99 and 100: Capítulo 4 Figura 4.3. Red de coex
Page 101 and 102: Capítulo 4 Si analizamos los genes
Page 103 and 104: Capítulo 4 se hizo comparando cont
Page 105: 4.4. Discusión y posible trabajo f
Page 108 and 109: Tesis Doctoral exones, y diseñando
Page 110 and 111: Tesis Doctoral expression and isofo
Page 112 and 113: Tesis Doctoral 37, e107. Gardina, P
Page 114 and 115: Tesis Doctoral and survival in chro
Page 116 and 117: Tesis Doctoral Roth, R.B., Hevezi,
Page 118 and 119: Tesis Doctoral Xi, L., Feber, A., G
Page 121 and 122: Risueño et al. BMC Bioinformatics
Page 131 and 132:
Risueño et al. BMC Bioinformatics
Page 133 and 134:
ORIGINAL ARTICLE Deregulation of mi
Page 135 and 136:
Targets component of miRecords inte
Page 137 and 138:
log 10 2-ΔCt -2.00 -4.00 -6.00 -8.
Page 139 and 140:
Table 4 Potential microRNA (miRNA)-
Page 141 and 142:
myeloma pathogenesis. Proc Natl Aca
Page 143 and 144:
genetic subtypes of CLL show differ
Page 145 and 146:
Table 2. Cont. Up-regulated Down-re
Page 147 and 148:
206 underexpressed in the 13q-H gro
Page 149 and 150:
Table 3. Most significant target ge
Page 151 and 152:
Discussion 13q deletion (13q-) is t
Page 153 and 154:
patients with 17p and 11q deletions
Page 155 and 156:
Human Gene Coexpression Landscape:
Page 157 and 158:
The similarity and proximity of the
Page 159 and 160:
As described in Methods we use a co
Page 161 and 162:
all data points of coexpression pai
Page 163 and 164:
Table 1. This work (2008) Pathway N
Page 165 and 166:
In conclusion, the functional consi
Page 167 and 168:
a total set of 48 microarrays. The
Page 169 and 170:
original article Annals of Oncology
Page 171 and 172:
Annals of Oncology original article
Page 173 and 174:
Page 175 and 176:
show all

Alberto Risueño Pérez - Gredos - Universidad de Salamanca

Create successful ePaper yourself

Delete template?

Save as template?