Tesis Doctoral Roth, R.B., Hevezi, P., Lee, J., Willhite, D., Lechner, S.M., Foster, A.C., and Zlotnik, A. (2006). Gene expression analyses reveal molecular relationships among 20 regions of the human CNS. Neurogenetics 7, 67-‐80. Rozman, C., and Montserrat, E. (1995). Chronic lymphocytic leukemia. N Engl J Med 333, 1052-‐1057. Scheffe, H. (1959). The Analysis of Variance (pp. xvi. 477. John Wiley & Sons: New York; Chapman & Hall: London). Schwen<strong>de</strong>r, H. (2012). siggenes: Multiple testing using SAM and Efron's empirical Bayes approaches. Shai, O., Morris, Q.D., Blencowe, B.J., and Frey, B.J. (2006). Inferring global levels of alternative splicing isoforms using a generative mo<strong>de</strong>l of microarray data. Bioinformatics 22, 606-‐613. Shannon, P., Markiel, A., Ozier, O., Baliga, N.S., Wang, J.T., Ramage, D., Amin, N., Schwikowski, B., and I<strong>de</strong>ker, T. (2003). Cytoscape: a software environment for integrated mo<strong>de</strong>ls of biomolecular interaction networks. Genome Res 13, 2498-‐2504. Shen, S., Warzecha, C.C., Carstens, R.P., and Xing, Y. (2010). MADS+: discovery of differential splicing events from Affymetrix exon junction array data. Bioinformatics 26, 268-‐269. Sigrist, C.J., Cerutti, L., <strong>de</strong> Castro, E., Langendijk-‐Genevaux, P.S., Bulliard, V., Bairoch, A., and Hulo, N. (2010). PROSITE, a protein domain database for functional characterization and annotation. Nucleic Acids Res 38, D161-‐166. Sing, T., San<strong>de</strong>r, O., Beerenwinkel, N., and Lengauer, T. (2005). ROCR: visualizing classifier performance in R. Bioinformatics 21, 3940-‐3941. Smith, C.W., and Valcarcel, J. (2000). Alternative pre-‐mRNA splicing: the logic of combinatorial control. Trends Biochem Sci 25, 381-‐388. Smoot, M.E., Ono, K., Ruscheinski, J., Wang, P.-‐L., and I<strong>de</strong>ker, T. (2011). Cytoscape 2.8: new features for data integration and network visualization. Bioinformatics 27, 431-‐432. Smyth, G. (2005). Bioinformatics and Computational Biology Solutions Using R and Bioconductor, R. Gentleman, V.J. Carey, W. Huber, R.A. Irizarry, and S. Dudoit, eds. (Springer New York), pp. 397-‐420. Smyth, G.K., Ritchie, M., and Thorne, N. (2012). limma: Linear Mo<strong>de</strong>ls for Microarray Data User ’ s Gui<strong>de</strong> ( Now Including RNA-‐Seq Data Analysis ). Spiegelman, B.M., and Heinrich, R. (2004). Biological Control through Regulated Transcriptional Coactivators. Cell 119, 157-‐167. Stalteri, M.A., and Harrison, A.P. (2007). Interpretation of multiple probe sets mapping to the same gene in Affymetrix GeneChips. BMC Bioinformatics 8, 13. Su, A.I., Wiltshire, T., Batalov, S., Lapp, H., Ching, K.A., Block, D., Zhang, J., So<strong>de</strong>n, R., Hayakawa, M., Kreiman, G., et al. (2004). A gene atlas of the mouse and human protein-‐encoding transcriptomes. Proc Natl Acad Sci U S A 101, 6062-‐6067. 112
Referencias Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by <strong>de</strong>fined factors. Cell 126, 663-‐676. Thanaraj, T.a., Stamm, S., Clark, F., Riethoven, J.-‐J., Le Texier, V., and Muilu, J. (2004). ASD: the Alternative Splicing Database. Nucleic Acids Res 32, D64-‐69. Tirosh, I., Weinberger, A., Carmi, M., and Barkai, N. (2006). A genetic signature of interspecies variations in gene expression. Nat Genet 38, 830-‐834. Tusher, V.G., Tibshirani, R., and Chu, G. (2001). Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98, 5116-‐5121. Uetz, P., Giot, L., Cagney, G., Mansfield, T.A., Judson, R.S., Knight, J.R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., et al. (2000). A comprehensive analysis of protein-‐protein interactions in Saccharomyces cerevisiae. Nature 403, 623-‐627. Uhlen, M. (2005). A Human Protein Atlas for Normal and Cancer Tissues Based on Antibody Proteomics. Mol Cell Proteomics 4, 1920-‐1932. Uhlen, M., Oksvold, P., Fagerberg, L., Lundberg, E., Jonasson, K., Forsberg, M., Zwahlen, M., Kampf, C., Wester, K., Hober, S., et al. (2010). Towards a knowledge-‐based Human Protein Atlas. Nat Biotechnol 28, 1248-‐1250. van Noort, V., Snel, B., and Huynen, M.A. (2004). The yeast coexpression network has a small-‐ world, scale-‐free architecture and can be explained by a simple mo<strong>de</strong>l. EMBO Rep 5, 280-‐284. Venables, J.P. (2004). Aberrant and alternative splicing in cancer. Cancer Res 64, 7647-‐7654. Venter, J.C., Adams, M.D., Myers, E.W., Li, P.W., Mural, R.J., Sutton, G.G., Smith, H.O., Yan<strong>de</strong>ll, M., Evans, C.A., Holt, R.A., et al. (2001). The sequence of the human genome. Science 291, 1304-‐1351. von Wangenheim, K.H., and Peterson, H.P. (2008). The role of cell differentiation in controlling cell multiplication and cancer. J Cancer Res Clin Oncol 134, 725-‐741. Wahl, M.C., Will, C.L., and Lührmann, R. (2009). The spliceosome: <strong>de</strong>sign principles of a dynamic RNP machine. Cell 136, 701-‐718. Wang, E.T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., Kingsmore, S.F., Schroth, G.P., and Burge, C.B. (2008). Alternative isoform regulation in human tissue transcriptomes. Nature 456, 470-‐476. Wang, H., Hubbell, E., Hu, J.s., Mei, G., Cline, M., Lu, G., Clark, T., Siani-‐Rose, M.A., Ares, M., Kulp, D.C., et al. (2003). Gene structure-‐based splice variant <strong>de</strong>convolution using a microarry platform. Bioinformatics 19, i315-‐i322. Wang, Z., Gerstein, M., and Sny<strong>de</strong>r, M. (2009). RNA-‐Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10, 57-‐63. Weinberg, R.A. (2007). The biology of cancer (New York ; London, Garland Science). Wodicka, L., Dong, H., Mittmann, M., Ho, M.H., and Lockhart, D.J. (1997). Genome-‐wi<strong>de</strong> expression monitoring in Saccharomyces cerevisiae. Nat Biotechnol 15, 1359-‐1367. 113
- Page 1:
Bioinformática aplicada a estudios
- Page 5 and 6:
Índice INTRODUCCIÓN GENERAL .....
- Page 7 and 8:
Introducción general Bioinformáti
- Page 9 and 10:
Figura 2. Proceso de transcripción
- Page 11 and 12:
Introducción general caciones, las
- Page 13 and 14:
Objetivos Introducción general La
- Page 15 and 16:
Capítulo 1 1.1.1. Bases de datos d
- Page 17 and 18:
Capítulo 1 sondas core y su inform
- Page 19 and 20:
caaatgacttgctattattgatggc 225 694 c
- Page 21 and 22:
presentes en el fichero. Capítulo
- Page 23 and 24:
Capítulo 1 Mus musculus MG_U74Av2
- Page 25 and 26:
Capítulo 1 Figura 1.5. Representac
- Page 27 and 28:
Capítulo 1 Paso 2 Descripción: As
- Page 29 and 30:
Capítulo 1 A la hora de escribir e
- Page 31 and 32:
Capítulo 1 en regiones no codifica
- Page 33 and 34:
Capítulo 1 Para optimizar la preci
- Page 35 and 36:
Figura 1.9a. Distribución del núm
- Page 37 and 38:
Capítulo 1 por contraste el númer
- Page 39 and 40:
Capítulo 1 (cromosoma, locus, exon
- Page 41 and 42:
Capítulo 1 figura 1.16). Además d
- Page 43 and 44:
Capítulo 1 exhaustivo en este ámb
- Page 45 and 46:
Capítulo 1 su presentación y deta
- Page 47:
Capítulo 1 adaptación para los mi
- Page 50 and 51:
Tesis Doctoral pueden agrupar en: t
- Page 52 and 53:
Tesis Doctoral enfermedad a través
- Page 54 and 55:
Tesis Doctoral los genes encontrado
- Page 56 and 57:
Tesis Doctoral real (RT-‐PCR).
- Page 58 and 59:
Tesis Doctoral muestras (ver figura
- Page 60 and 61:
Tesis Doctoral subtipo fueron: 0.97
- Page 62 and 63:
Tesis Doctoral En este trabajo se h
- Page 64 and 65:
Tesis Doctoral permitiría, sin dud
- Page 66 and 67: Tesis Doctoral inclusión entre 0 y
- Page 68 and 69: Tesis Doctoral exacto del número d
- Page 70 and 71: Tesis Doctoral Los valores extremos
- Page 72 and 73: Tesis Doctoral dicho, la comparaci
- Page 74 and 75: Tesis Doctoral 70 Figura 3.6. Los d
- Page 76 and 77: Tesis Doctoral 3.8.b). Sin embargo
- Page 78 and 79: Tesis Doctoral Human Exon 1.0. La l
- Page 80 and 81: Tesis Doctoral 76 Figura 3.10. Curv
- Page 82 and 83: Tesis Doctoral 78 Figura 3.10 (cont
- Page 84 and 85: Tesis Doctoral del inicio del ranki
- Page 87 and 88: Capítulo 4 Análisis de coexpresi
- Page 89 and 90: Capítulo 4 los genes y la perspect
- Page 91 and 92: Capítulo 4 Utilizando el set de da
- Page 93 and 94: ENSG00000142541 RPL13A small nucleo
- Page 95 and 96: Capítulo 4 Para encontrar los gene
- Page 97 and 98: Capítulo 4 ENSG00000134287 ARF3 AD
- Page 99 and 100: Capítulo 4 Figura 4.3. Red de coex
- Page 101 and 102: Capítulo 4 Si analizamos los genes
- Page 103 and 104: Capítulo 4 se hizo comparando cont
- Page 105: 4.4. Discusión y posible trabajo f
- Page 108 and 109: Tesis Doctoral exones, y diseñando
- Page 110 and 111: Tesis Doctoral expression and isofo
- Page 112 and 113: Tesis Doctoral 37, e107. Gardina, P
- Page 114 and 115: Tesis Doctoral and survival in chro
- Page 118 and 119: Tesis Doctoral Xi, L., Feber, A., G
- Page 121 and 122: Risueño et al. BMC Bioinformatics
- Page 123 and 124: Risueño et al. BMC Bioinformatics
- Page 125 and 126: Risueño et al. BMC Bioinformatics
- Page 127 and 128: Risueño et al. BMC Bioinformatics
- Page 129 and 130: Risueño et al. BMC Bioinformatics
- Page 131 and 132: Risueño et al. BMC Bioinformatics
- Page 133 and 134: ORIGINAL ARTICLE Deregulation of mi
- Page 135 and 136: Targets component of miRecords inte
- Page 137 and 138: log 10 2-ΔCt -2.00 -4.00 -6.00 -8.
- Page 139 and 140: Table 4 Potential microRNA (miRNA)-
- Page 141 and 142: myeloma pathogenesis. Proc Natl Aca
- Page 143 and 144: genetic subtypes of CLL show differ
- Page 145 and 146: Table 2. Cont. Up-regulated Down-re
- Page 147 and 148: 206 underexpressed in the 13q-H gro
- Page 149 and 150: Table 3. Most significant target ge
- Page 151 and 152: Discussion 13q deletion (13q-) is t
- Page 153 and 154: patients with 17p and 11q deletions
- Page 155 and 156: Human Gene Coexpression Landscape:
- Page 157 and 158: The similarity and proximity of the
- Page 159 and 160: As described in Methods we use a co
- Page 161 and 162: all data points of coexpression pai
- Page 163 and 164: Table 1. This work (2008) Pathway N
- Page 165 and 166: In conclusion, the functional consi
- Page 167 and 168:
a total set of 48 microarrays. The
- Page 169 and 170:
original article Annals of Oncology
- Page 171 and 172:
Annals of Oncology original article
- Page 173 and 174:
Annals of Oncology original article
- Page 175 and 176:
Annals of Oncology original article