THESE Maryse Bonnin Jusserand - Université de Bourgogne

More documents

Recommendations

Info

Abstract Résultats Ornithine decarboxylase (ODC) is responsible for the production of putrescine, the major biogenic amine found in wine. Oenococcus oeni is the most important lactic acid bacterium (LAB) in the winemaking process and is involved in malolactic fermentation. We report here the characterization of ODC from an O. oeni strain isolated from wine. Screening of 263 strains isolated from wine and cider from all over the world, revealed that the presence of the odc gene appears to be strain-specific in O. oeni. After cloning, heterologous expression in E. coli and characterization, the enzyme showed a MW of 85kDa and a pI of 6.2 and revealed maximal activity at pH 5.5 and an optimum temperature of 35°C. Kinetic studies showed that O. oeni ODC is specific for L-ornithine with a Km value of 1 mM and a Vmax of 0.57 U.mg -1 . The hypothesis that cadaverine, which results from lysine decarboxylation, may be linked to putrescine production does not stand up since O. oeni ODC cannot decarboxylate L-lysine. As no lysine decarboxylase was detected in any of the O. oeni genomes sequenced, cadaverine synthesis may result from another metabolic pathway. This work is the first characterization of an ODC from a LAB isolated from a fermented product. 106
Résultats All fermented foods (dairy products, beer, wine, cider, soybean sauces, fermented sausages, etc.) carry the risk of biogenic amine contamination (18, 17). High amounts of these molecules can cause undesirable physiological effects and can negatively alter the organoleptic properties of contaminated products (4). Indeed, the aromatic amines, histamine and tyramine, are regarded as undesirable compounds because of the potential toxic effects derived from their vasoactive and psychoactive properties (21). There are two types of amino acid catabolic pathways that lead to biogenic amine formation. The decarboxylation pathways involve only two proteins, a decarboxylase and a transporter protein. The former converts the amino acid in the cytoplasm into the biogenic amine and carbon dioxide; the latter is responsible for the uptake of the amino acid from the medium and the excretion of the amine in an exchange process. The physiological role of amino acid decarboxylative pathways in microorganisms is still uncertain: amine accumulation is generally considered a defense mechanism used by bacteria to counter an acidic environment (14, 1) but also a means to obtain metabolic energy through an electrogenic amino acid/amine antiport system leading to the generation of proton motive force (14). The latter function is particularly important in microorganisms that lack a respiratory chain to generate high ATP yields, such as lactic acid bacteria (LAB) (9). Among the predominant LAB associated with wine fermentation, Lactobacillus, Leuconostoc, and Pediococcus genera have been shown to produce biogenic amines (16). Oenococcus oeni, the bacterial species most commonly found in wines and most frequently associated with malolactic fermentation (MLF), has been reported to produce histamine (3). Regarding putrescine production, in silico analysis of the three Oenococcus oeni genomes available did not reveal the presence of any odc homologs. Consistent with this, Granchi et al. (6) did not detect any putrescine producer among the 42 Oenococcus oeni strains tested. In contrast, Guerrini et al. (7) and Marcobal et al. (12) isolated Oenococcus oeni strains that did produce putrescine. Moreover, Marcobal et al. (12) identified an odc gene encoding a 745- amino-acid putative decarboxylase (ODC) (EC 4.1.1.17). The biochemical characterization of ornithine decarboxylase has been poorly studied in bacteria and especially in lactic acid bacteria (8). Despite the importance of biogenic amines in fermented products, no studies have been conducted on lactic acid bacteria isolated from this environment. Only one study has reported the biochemical properties of ODC in a laboratory lactic acid bacterium, the collection strain Lactobacillus sp 30a previously isolated 107
Page 1 and 2:
Université de Bourgogne Institut U
Page 3 and 4:
Sommaire Sommaire INTRODUCTION ....
Page 5 and 6:
Sommaire C. Le sulfitage et les enz
Page 7 and 8:
Sommaire RESULTATS ................
Page 9 and 10:
Table des figures mobilisable (ou c
Page 11 and 12:
Tables des tableaux Table des table
Page 13 and 14:
Introduction Pour faire face à ce
Page 15 and 16:
Synthèse bibliographique utilisée
Page 17 and 18:
Synthèse bibliographique biochimiq
Page 19 and 20:
Synthèse bibliographique primaires
Page 21 and 22:
Synthèse bibliographique sont des
Page 23 and 24:
Synthèse bibliographique V. Foncti
Page 25 and 26:
Synthèse bibliographique contre un
Page 27 and 28:
Synthèse bibliographique Amines bi
Page 29 and 30:
Synthèse bibliographique précurse
Page 31 and 32:
Synthèse bibliographique mg.kg 1 e
Page 33 and 34:
Synthèse bibliographique phosphate
Page 35 and 36:
1) Quantification des amines biogè
Page 37 and 38:
Synthèse bibliographique appartena
Page 39 and 40:
E. Le pH Synthèse bibliographique
Page 41 and 42:
Synthèse bibliographique biogènes
Page 43 and 44:
Synthèse bibliographique La séque
Page 45 and 46:
Synthèse bibliographique plus, le
Page 47 and 48:
Synthèse bibliographique Figure 9.
Page 49 and 50:
a b Synthèse bibliographique porta
Page 51 and 52:
Synthèse bibliographique Figure 11
Page 53 and 54:
Synthèse bibliographique biogènes
Page 55 and 56: Chapitre II : Les outils moléculai
Page 57 and 58: Synthèse bibliographique M17) et l
Page 59 and 60: Synthèse bibliographique Les trans
Page 61 and 62: Synthèse bibliographique Figure 14
Page 63 and 64: Synthèse bibliographique fonction
Page 65 and 66: Synthèse bibliographique l’absen
Page 67 and 68: II. Criblage des souches productric
Page 69 and 70: Matériels et méthodes 10 µL de r
Page 71 and 72: Matériels et méthodes (BioRad),
Page 73 and 74: Matériels et méthodes A. Construc
Page 75 and 76: Matériels et méthodes réaction d
Page 77 and 78: Matériels et méthodes autour de l
Page 79 and 80: Matériels et méthodes un substrat
Page 81 and 82: Figure 21. Evolution du pourcentage
Page 83 and 84: Histamine Tryptamine Cadavérine Ma
Page 85 and 86: Matériels et méthodes sur la colo
Page 87 and 88: Chapitre III : transcriptomique La
Page 89 and 90: ΔCT = CT (témoin interne) - CT (g
Page 91 and 92: RESULTATS Résultats Ma thèse s’
Page 93 and 94: A. L’histamine dans la résistanc
Page 95 and 96: Résultats été répétée en mili
Page 97 and 98: Résultats présence de 25 mM d’h
Page 99 and 100: Résultats Figure 29. Mesure de l
Page 101 and 102: Figure 30. Carte du vecteur suicide
Page 103 and 104: Résultats Suite aux différents é
Page 105: Molecular cloning, heterologous exp
Page 109 and 110: Résultats Madison WI USA), 1.5 µl
Page 111 and 112: Résultats reaction was started by
Page 113 and 114: Résultats Figure 1: Geographical d
Page 115 and 116: 5 Lactobacillus DFGVPATIVANYLRDHGII
Page 117 and 118: Résultats Figure 5: Effect of pH (
Page 119 and 120: Résultats enzymes are carried on a
Page 121 and 122: Résultats 13-Marcobal, A., B. de l
Page 123 and 124: Article 2 Tyrosine-containing pepti
Page 125 and 126: Abstract Résultats Biogenic amines
Page 127 and 128: Résultats Although free AA are pre
Page 129 and 130: Résultats splitter (split ratio =
Page 131 and 132: Table 1: Oligonucleotides used in t
Page 133 and 134: Table 2: Identification of amines b
Page 135 and 136: Résultats strains, do not carry th
Page 137 and 138: Résultats (Strahinic et al, 2009),
Page 139 and 140: Résultats Duary RK, Batish VK & Gr
Page 141 and 142: Résultats Nannelli F, Claisse O, G
Page 143 and 144: Discussion-Perspectives décarboxyl
Page 145 and 146: Discussion-Perspectives plupart du
Page 147 and 148: ANNEXES Annexes 147
Page 149 and 150: Annexes d’utiliser cet hôte pour
Page 151 and 152: Annexes surface des vésicules pert
Page 153 and 154: Annexes mécanismes, en particulier
Page 155 and 156: Annexes Afin de vérifier l’effic
Page 157 and 158:
Annexes Marty-Teysset C., Lolkema J
Page 159 and 160:
evis GAAGTTAATCAAGAATTAGTTGCCGGCAAG
Page 161 and 162:
curvatus AGCTGGTAAAGTAACGGTTCTTCGGG
Page 163 and 164:
Références Arena M.E., Manca de N
Page 165 and 166:
Références Bonetta S., Carraro E.
Page 167 and 168:
Références Capozzi V., Ladero V.,
Page 169 and 170:
Références Coton M., Fernandez M.
Page 171 and 172:
Références Endo, A., Okada, S., R
Page 173 and 174:
Références Gerbaux V., Villa A.,
Page 175 and 176:
Références Jobin M.-P., Garmyn D.
Page 177 and 178:
Références Landete J. M., Pardo I
Page 179 and 180:
Références Lonvaud-Funel A. & Joy
Page 181 and 182:
Références Marques A. P., Leitao
Page 183 and 184:
N Références Nakada Y., Itoh Y.,
Page 185 and 186:
Références Pramateftaki P.V., Met
Page 187 and 188:
Références Sato T., Fukui T., Ato
Page 189 and 190:
Références Teissie J., Rols M.P.,
Page 191 and 192:
W-X Références Wei M.Q., Rush C.M
Page 193 and 194:
RESUME Résumé Les amines biogène
show all

THESE Maryse Bonnin Jusserand - Université de Bourgogne

Create successful ePaper yourself

Delete template?

Save as template?