THESE Maryse Bonnin Jusserand - Université de Bourgogne

Résultats
from a horse stomach (8). In some bacteria like Selenomonas ruminantium (19), Vibrio
vulnificus (10) and recently Staphylococcus epidermidis (2) it has been shown that ODC was
also responsible for cadaverine production by lysine decarboxylation. Like putrescine,
cadaverine is another diamine found in wine. These two molecules also called respectively
diaminobutane and diaminopentane are chemically closed and could be produced via the same
pathway. However in Oenococcus oeni, the origin of cadaverine is unknown and might be
synthesized by ODC from lysine like in Staphylococcus epidermidis. Indeed Guerrini et al.
(7), in a study of O. oeni producers, reported that putrescine and cadaverine are jointly
produced. The purpose of the present work was to gain deeper insights into putrescine
production by O. oeni given that the production of putrescine is a relevant property in food
quality and safety.
Materials and methods
Bacterial Strains, Plasmids, Media, and Chemicals
A collection of 263 Oenococcus oeni isolates obtained from wines or cider from all over the
world was used in this work (Fig 1).
O. oeni odc+ strains were tested for putrescine and cadaverine production in LAC medium
composed of 78 mL. L -1 white grape juice, 33 g. L -1 yeast extract, 0,6 mL. L -1 tween 80 and
0,8 g. L -1 MnSO4, H2O, pH 5.
Escherichia coli strain ER2738 was used as the host for gene cloning and strain BL21 (DE3)
for plasmid propagation. pCR-XL-TOPO vector (Invitrogen) was used for sub-cloning, while
pET-28a (Novagen) was used as the cloning and expression vector. BamHI and NdeI were
purchased from Invitrogen and Ni-NTA resin from QIAGEN.
Screening for the presence of the odc gene
Screening for the ornithine decarboxylase gene was performed by polymerase chain reaction
(PCR). Genomic DNA was extracted from bacterial cultures grown to the stationary phase
with the DNeasy Tissue Kit (QIAGEN, France). The primers ODC V1 (5'
AATAAGAGTTTAC ATTGGGGAA3') and ODC V3
(5'TGAGTTTCTGCAGGTGTCATT3) were used to amplify a fragment of 1900 bp from the
odc gene. The 25µl reaction mix contained 5 µl of 5X Green GoTaq Flexi buffer (Promega,
108