M Références Mah J-H., Hwang H-J., Inhibition of biogenic amine formation in a salted and fermented anchovy by Staphylococcus xylosus as a protective culture, 2009, Food Control, 20: 796-801. Maijala R., Formation of histamine and tyramine by some lactic acid bacteria in MRS broth and modified <strong>de</strong>carboxylation agar, 1993, Letters in Applied Microbiology, 17: 40-43. Makarova K., Slesarev A., Wolf Y., Sorokin A., Mirkin B., Koonin E., Pavlov A., Pavlova N., Karamychev V. & autres auteurs, Comparative genomics of the lactic acid bacteria, 2006, PNAS USA, 103: 15611-15616. Maldonado A., Ruiz-Barba J.L., Jimenez-Díaz R., Purification and genetic characterization of plantaricin NC8,a novel coculture-inducible two-pepti<strong>de</strong> bacteriocin from Lactobacillus plantarum NC8, 2003, Applied and Environmental Microbiology, 69: 383-389. Manfroi L., Silva P. H. A., Rizzon L. A., Sabaini P. S., Gloria M. B. A., Influence of alcoholic and malolactic starter cultures on bioactive amines in Merlot wines, 2009, Food Chemistry, 116: 208-213. Mangani S., Guerrini S., Granchi L., Vincenzini M., Putrescine Accumulation in Wine: Role of Oenococcus oeni, 2005, Current Microbiology, 51 : 6-10. Mangani S., Guerrini S., Granchi L., Vincenzini M., Putrescine accumulation in wine: role of Oenococcus oeni, 2005, Current Microbiology, 51: 6-10. Marcobal A., De Las Rivas B., Moreno-Arribas M.V., Munoz R., Evi<strong>de</strong>nce for horizontal gene transfer as origin of putrescine production in Oenococcus oeni RM83, 2006, Applied and environmental Microbiology, 72: 7954-7958. Marcobal A., Polo M.C., Martin-Alvarez P.J., Moreno-Arribas M.V., Biogenic amine content of red Spanish wines: comparison of a direct ELISA and an HPLC method for the <strong>de</strong>termination of histamine in wines, 2005, Food Research International, 38: 387-394. 180
Références Marques A. P., Leitao M. C., San Romao M. V., Biogenic amines in wines: influence of oenological factors, 2008, Food Chemistry, 107: 853-860. Martın M.C., Fernan<strong>de</strong>z M., Linares D.M., Alvarez M.A., Sequencing, characterization and transcriptional analysis of the histidine <strong>de</strong>carboxylase operon of Lactobacillus buchneri, 2005, Microbiology, 151: 1219-1228. Marty-Teysset C., Lolkema J. S., Schmitt P., Divies C., Konings W. N., Membrane potential- generating transport of citrate and malate catalyzed by CitP of Leuconostoc mesenteroi<strong>de</strong>s, 1995, The Journal of Biological Chemistry, 270: 25370-25376. Marty-Teysset C., Posthuma C., Lolkema J.S., Schmitt P., Divies C., Konings W.N., Proton motive force generation by citrolactic fermentation in Leuconostoc mesenteroi<strong>de</strong>s, 1996, Journal of Bacteriology, 178: 2178-2185. Masson F., Talon R., Montel M.C., Histamine and tyramine production by bacteria from meat products, 1996, International Journal of Food Microbiology, 32: 199-207. Mazzoli R., Lamberti C., Coisson J.D., Purrotti M., Arlorio M., Giuffrida M.G., Giunta C., Pessione E., Influence of ethanol, malate and arginine on histamine production of Lactobacillus hilgardii isolated from an Italian red wine, 2008, Amino Acids, 36: 81-89. Mbarki R., Ben Miloud N., Selmi S., Dhib S., Sadok S., Effect of vacuum packaging and low- dose irradiation on the microbial,chemical and sensory characteristics of chub mackerel (Scomber japonicus), 2009, Food Microbiology, 26: 821-826. Meroz A., 2009, Les amines biogènes dans les vins: impact d’une souche <strong>de</strong> bactérie lactique sélectionnée et <strong>de</strong> l’élevage sur lies, sur la production d’amines biogènes lors <strong>de</strong> la FML <strong>de</strong> vin <strong>de</strong> Pinot Noir, Mémoire DNO, Dijon. Mesas J.M., Rodriguez M.C., Alegre M.T., Nucleoti<strong>de</strong> sequence analysis of pRS2 and pRS3, two small cryptic plasmids from Oenococcus oeni, 2001, Plasmid, 46: 149-151. 181
- Page 1 and 2:
Université de Bourgogne Institut U
- Page 3 and 4:
Sommaire Sommaire INTRODUCTION ....
- Page 5 and 6:
Sommaire C. Le sulfitage et les enz
- Page 7 and 8:
Sommaire RESULTATS ................
- Page 9 and 10:
Table des figures mobilisable (ou c
- Page 11 and 12:
Tables des tableaux Table des table
- Page 13 and 14:
Introduction Pour faire face à ce
- Page 15 and 16:
Synthèse bibliographique utilisée
- Page 17 and 18:
Synthèse bibliographique biochimiq
- Page 19 and 20:
Synthèse bibliographique primaires
- Page 21 and 22:
Synthèse bibliographique sont des
- Page 23 and 24:
Synthèse bibliographique V. Foncti
- Page 25 and 26:
Synthèse bibliographique contre un
- Page 27 and 28:
Synthèse bibliographique Amines bi
- Page 29 and 30:
Synthèse bibliographique précurse
- Page 31 and 32:
Synthèse bibliographique mg.kg 1 e
- Page 33 and 34:
Synthèse bibliographique phosphate
- Page 35 and 36:
1) Quantification des amines biogè
- Page 37 and 38:
Synthèse bibliographique appartena
- Page 39 and 40:
E. Le pH Synthèse bibliographique
- Page 41 and 42:
Synthèse bibliographique biogènes
- Page 43 and 44:
Synthèse bibliographique La séque
- Page 45 and 46:
Synthèse bibliographique plus, le
- Page 47 and 48:
Synthèse bibliographique Figure 9.
- Page 49 and 50:
a b Synthèse bibliographique porta
- Page 51 and 52:
Synthèse bibliographique Figure 11
- Page 53 and 54:
Synthèse bibliographique biogènes
- Page 55 and 56:
Chapitre II : Les outils moléculai
- Page 57 and 58:
Synthèse bibliographique M17) et l
- Page 59 and 60:
Synthèse bibliographique Les trans
- Page 61 and 62:
Synthèse bibliographique Figure 14
- Page 63 and 64:
Synthèse bibliographique fonction
- Page 65 and 66:
Synthèse bibliographique l’absen
- Page 67 and 68:
II. Criblage des souches productric
- Page 69 and 70:
Matériels et méthodes 10 µL de r
- Page 71 and 72:
Matériels et méthodes (BioRad),
- Page 73 and 74:
Matériels et méthodes A. Construc
- Page 75 and 76:
Matériels et méthodes réaction d
- Page 77 and 78:
Matériels et méthodes autour de l
- Page 79 and 80:
Matériels et méthodes un substrat
- Page 81 and 82:
Figure 21. Evolution du pourcentage
- Page 83 and 84:
Histamine Tryptamine Cadavérine Ma
- Page 85 and 86:
Matériels et méthodes sur la colo
- Page 87 and 88:
Chapitre III : transcriptomique La
- Page 89 and 90:
ΔCT = CT (témoin interne) - CT (g
- Page 91 and 92:
RESULTATS Résultats Ma thèse s’
- Page 93 and 94:
A. L’histamine dans la résistanc
- Page 95 and 96:
Résultats été répétée en mili
- Page 97 and 98:
Résultats présence de 25 mM d’h
- Page 99 and 100:
Résultats Figure 29. Mesure de l
- Page 101 and 102:
Figure 30. Carte du vecteur suicide
- Page 103 and 104:
Résultats Suite aux différents é
- Page 105 and 106:
Molecular cloning, heterologous exp
- Page 107 and 108:
Résultats All fermented foods (dai
- Page 109 and 110:
Résultats Madison WI USA), 1.5 µl
- Page 111 and 112:
Résultats reaction was started by
- Page 113 and 114:
Résultats Figure 1: Geographical d
- Page 115 and 116:
5 Lactobacillus DFGVPATIVANYLRDHGII
- Page 117 and 118:
Résultats Figure 5: Effect of pH (
- Page 119 and 120:
Résultats enzymes are carried on a
- Page 121 and 122:
Résultats 13-Marcobal, A., B. de l
- Page 123 and 124:
Article 2 Tyrosine-containing pepti
- Page 125 and 126:
Abstract Résultats Biogenic amines
- Page 127 and 128:
Résultats Although free AA are pre
- Page 129 and 130: Résultats splitter (split ratio =
- Page 131 and 132: Table 1: Oligonucleotides used in t
- Page 133 and 134: Table 2: Identification of amines b
- Page 135 and 136: Résultats strains, do not carry th
- Page 137 and 138: Résultats (Strahinic et al, 2009),
- Page 139 and 140: Résultats Duary RK, Batish VK & Gr
- Page 141 and 142: Résultats Nannelli F, Claisse O, G
- Page 143 and 144: Discussion-Perspectives décarboxyl
- Page 145 and 146: Discussion-Perspectives plupart du
- Page 147 and 148: ANNEXES Annexes 147
- Page 149 and 150: Annexes d’utiliser cet hôte pour
- Page 151 and 152: Annexes surface des vésicules pert
- Page 153 and 154: Annexes mécanismes, en particulier
- Page 155 and 156: Annexes Afin de vérifier l’effic
- Page 157 and 158: Annexes Marty-Teysset C., Lolkema J
- Page 159 and 160: evis GAAGTTAATCAAGAATTAGTTGCCGGCAAG
- Page 161 and 162: curvatus AGCTGGTAAAGTAACGGTTCTTCGGG
- Page 163 and 164: Références Arena M.E., Manca de N
- Page 165 and 166: Références Bonetta S., Carraro E.
- Page 167 and 168: Références Capozzi V., Ladero V.,
- Page 169 and 170: Références Coton M., Fernandez M.
- Page 171 and 172: Références Endo, A., Okada, S., R
- Page 173 and 174: Références Gerbaux V., Villa A.,
- Page 175 and 176: Références Jobin M.-P., Garmyn D.
- Page 177 and 178: Références Landete J. M., Pardo I
- Page 179: Références Lonvaud-Funel A. & Joy
- Page 183 and 184: N Références Nakada Y., Itoh Y.,
- Page 185 and 186: Références Pramateftaki P.V., Met
- Page 187 and 188: Références Sato T., Fukui T., Ato
- Page 189 and 190: Références Teissie J., Rols M.P.,
- Page 191 and 192: W-X Références Wei M.Q., Rush C.M
- Page 193 and 194: RESUME Résumé Les amines biogène