THESE Maryse Bonnin Jusserand - Université de Bourgogne

Résultats
Although free AA are precursors of BA, one can wonder whether peptides could be directly
BA precursors too, as peptides are also present in wine and participate at the enrichment in
nitrogen. Moreover, LAB performing MLF have a proteolytic system and could degrade
peptides in the extracellular or intracellular medium and then decarboxylate AA to produce
BA. Indeed, O. oeni exhibits a proteolytic activity against peptides from white and red wine
(Manca de Nadra et al, 1997, Manca de Nadra et al, 1999). Furthermore an extracellular
protein with protease activity EprA has been characterized (Folio et al, 2008). Nevertheless, it
seems that O. oeni proteolytic activity is dependent on medium composition and bacterial
growth phase (Leitao et al, 2000). Also regarding Lactobacillus plantarum, a proteinase
named PrtP was identified for one isolate (Strahinic et al, 2009). The aim of this study was to
test the ability of L. plantarum to produce tyramine from synthetic peptides containing
tyrosine, and to investigate if peptides are metabolised, that is to say either inside the cell or in
the extracellular medium.
Materials and methods
Strain
Lactobacillus plantarum IR BL0076 (provided by B. Bach, Inter-Rhône, France) was isolated
from wines of the Rhône Valley during aging. This strain produces tyramine and was chosen
to conduct the experiments.
L. plantarum identification
L. plantarum DNA was extracted using the Wizard Genomic Kit (Promega). Then a PCR with
the 16S rRNA universal primers BSF8 (AGAGTTTGATCCTGGCTCAG) and BSR1541
(AAGGAGGTGATCCAGCCGCA) (Edwards et al, 1989) was performed with the following
amplification program: 95°C, 5 min; 30 cycles of 95°C, 30s; 52°C, 30s; 72°C, 1 min 30s with
a final extension at 72°C during 10 min. The amplification fragment was then sequenced after
analysis of the PCR sample on agarose gel 1% in TAE (40 mM Tris-acetate, 1 mM EDTA,
pH8) buffer.
Culture conditions
L. plantarum IR BL0076 was inoculated at OD600nm = 0.025 in a synthetic medium containing
the following components without nitrogen: 5 g.L -1 glucose, 3.5 g.L -1 fructose, 10 g.L -1 D,L-
127