Scientific Papers Series B Horticulture

More documents

Recommendations

Info

and Vilanova et al. (2003a; 46% and 42%,respectively) in apricot. Additionally, the SSRs,(PGS1_24)-F:CTCTTCTCGCCTCCCAATTTwith R:GCTTAGCCCTGGGTACAAG andF:ATCTGCTCTTTCCCTCACCT withR:GATTATCCCTCAACCCATCC weresignificant for the first screening in a lagerpopulation and may be useful for starting aMAS in breeding for PPV resistance. Furtherevaluation of these loci will be necessary tocharacterize the genetic control of the PPVresistance trait. Due to the co-dominant natureof SSRs along with their high genetictransportability, the development of SSRsassociated with PPV resistance in apricot couldfacilitate the use of MAS in breeding strategiesaimed at breeding for natural resistance.Table 1. Results concerning the implement of markersPGS 1,24 and Ppb0022-195 in Romanian progenies.GénotypePpb0022-195 MapdistancecMPpb0022-195Mapdist..cMPGS124Mapdist.cMPGS124Mapdist.cMKesthPhor 112.01 129.53 Viceroy 111.96 100.93 H2+ 107 116.4 98.93 102.9MariCenad 111.98 100.92 NJA 17 107.01 112.01 98.9 100.91Cristal 111.84 100.78 102.73Sirena 111.81 100.78 127.76Tabriz 112.01 100.88 SEO 107.11 111.97 98.9 100.91Pop3-37 111.9 100.79 Pop3-38 111.83 129.42 Pop3-42 111.9 102.73 129.43Pop3-49 111.93 129.42 Pop3-64 107.05 111.98 98.89 100.92Pop3-65 112 129.62 Pop3-68 107.13 98.88 102.93Pop3-71 Pop3-73 107.08 98.94 Pop3-74 107.12 112.03 98.96 127.93Pop3-76 107.1 112.04 98.94 129.24Pop3-77 106.97 98.76 Pop3-78 111.91 100.81 Pop3-79 106.94 111.91 98.81 102.76Pop3-80 106.97 111.92 98.78 100.83Pop3-81 111.9 100.77 Pop1-20 107.08 112 98.94 100.96Pop1-21 111.88 102.75 129.09Pop1-22 111.89 129.18 Pop1-55 106.96 111.86 98.8 127.76Pop1-72 106.98 11.87 9875 137.97Pop2-106 107.01 111.91 102.81 106.46Pop2-14 107.03 11.87 98.74 100.78Pop2-17 11.92 102.85 Pop2-43 11.93 100.89 102.89Pop2-47 107.06 111.99 100.87 106.51Pop2-66 111.91 101.81 102.78Pop2-63 111.97 100.85 102.83Pop2-69 107 106.37 Pop2-70 111.92 100.81 102.74Pop2-82 111.84 100.75 Pop4-104 111.92 102.9 129.28Pop4-19 107.03 111.95 98.88 129.3Pop4-45 107.07 111.92 98.83 129.22Pop4-46 107.12 111.98 98.94 129.32Pop4-48 107.91 98.75 Pop4-54 106.97 111.91 98.74 129.11pop4-59 106.94 111.87 98.74 129.13pop5.51 112.3 100.97 Pop5-52 112.4 100.95 pop5-53 107.1 112.01 98.86 100.94Pop 1 = Population 1 obtained by crosses ‘Mari de Cenadx SEO’Pop 2 = Population 2 obtained by crosses ‘Sirena x NJA42’Pop 3 = Population 3 obtained by crosses between (‘Maride Cenad, x,NJA 17’) x ‘Kesth Pshor’Pop 4 = Population 4 obtained by crosses ‘Cristal x NJA21’Pop 5 = population 5 obtained by crosses between(‘Viceroy’, x,NJA 2’) x ‘NJA17’For the marker ‘Ppb0022-195’ the region withresistance is situate between 107 / 112 (Tab. 1)The success of markers detection of PPV wasconfirmed to depend on the quality andquantity of isolated DNA during theexperiments and (Guilford et all., 1997) applieda similar method of isolation in CTAB buffer.CONCLUSIONSTargeted SSR analysis is a very direct way tolink the molecular markers to a trait of interest.SSR markers developed for specific genomeregions have been used to identify genes ofagronomic importance for evidence of selectionduring domestication in maize (Vigouroux etall., 2002) and to verify wheat–barleyintrogression (Hernandez et all, 2002). Theyare the most likely candidates for MAS in cropsof economical importance and appear to besuitable for apricot as well (Ribaut andHoisington, 1998; Badenes and Llacer, 2006).The identifying of a natural source of resistanceto PPV, using this resistant source into newcrosses with Romanian commercial cultivars179
well adapted in our country, and the implementof marker-assisted selection (MAS), based onmarkers tightly associated with resistance, as ameasure to substantially streamline thebreeding process, may be a promising strategyto obtain apricot varieties with natural geneticresistance to PPV.First couple of markers PGS 1.21 (Reverse andForward) could be enough for the screening ofa larger population of apricot and then start todevelop the others SSRs associated with PPVresistance to facilitate the use of MAS inRomanian apricot breeding programACKNOWLEDGEMENTSThis paper presents data from PhD thesis partof the project POSDRU/107/1.5/S/76888,funded by European Social Fund through theSectorial Operational Programme HumanResources Development 2007-2013.REFERENCESAudergon J-M., Dosba F., Karayiannis I., Dicenta F.,1994. Amélioration de l’abricotier pour la résistanceá la sharka. EPPO Bul 24, p. 741–748.Aranzana M., Pineda A., Cosson P., Dirlewanger E.,Ascasibar J., Cipriani G., Ryder C., Testolin R.,Abbott A., King G., Iezzoni A., Arús P., 2003. A setof simple-sequence repeat (SSR) markers coveringthe Prunus genome. Theor Appl Genet 106, p. 819–825.Badenes M.L., Llácer G., 2006. Breeding for resistance:breeding for Plum pox virus resistant apricots(Prunus armeniaca L.) in Spain. BulletinOEPP/EPPO Bulletin 36, p. 323–326.Bassi D., Bellini E., Guerriero R., Monastra F., PennoneF., 1995. Apricot breeding in Italy. ActaHorticulturae 384, p. 47–54.Dicenta F., Martinez-Gómez P., Burgos L., Egea J.,2000. Inheritance of resistance to plum potyvirus(PPV) in apricot, Prunus armeniaca. Plant Breeding119, p. 161–164.Dosba F., Orliac S., Dutrannoy F., Maison P., MassonieG., Audergon J-M., 1992. Evaluation of resistance toplum pox virus in apricot trees. Acta Horticulturae309, p. 211–220Egea J., Burgos L., Martínez-Gómez P., Dicenta F.,1999. Apricot breeding for sharka resistance at theCEBAS-CSIC, Murcia (Spain). Acta Horticulturae488, p. 153–157.Guilford P., Prakash S., Zhu J.M., Rikkerink E., GardinerS., Bassett H., Forster R., 1997. Microsatellites inMalus×domestica (apple): abundance, polymorphismand cultivar identification. Theor. Appl. Genet., 94,p. 249–254.Hernández P., Dorado G., Cabrera A., Laurie D.A.,Snape J.W., Martín A., 2002. Rapid verification ofwheat-Hordeum introgression by direct staining ofSCARS, STS, and SSR amplicons. Genome 45, p.198–203.Hurtado M.A., Romero C., Vilanova S., Abbott A.G.,Llacer G., Badenes M.L., 2002. Genetic linkage mapof two apricot cultivars (Prunus armeniaca L.) andmapping of PPV (sharka) resistance. Theor ApplGenet 105, p. 182–192.Karayiannis I., Mainou A., Tsaftaris A., 1999. Apricotbreeding in Greece for fruit quality and resistance toplum pox virus. Acta Horticulturae 488, p. 111–117.Karayiannis I., Thomidis T., Tsaftaris A., 2007.Inheritance of resistance to Plum pox virus in apricot(Prunus armeniaca L.). Tree Genetics & GenomesDOI 10.1007/s11295-007-0095-z.Krška B., Salava J., Polák J., Komínek P., 2002.Inheritance of resistance to plum pox virus in apricot.Plant Protection Sci 38, p. 180–182.Krška B., Vachun Z., Necas T., 2005. The apricotbreeding program at the <strong>Horticulture</strong> faculty inLednice. Acta Horticulturae 717, p. 145– 148.Lambert P., Dicenta F., Rubio M., Audergon J.M., 2007.QTL analysis of resistance to sharka disease in theapricot (Prunus armeniaca L.) ‘Polonais’ x ‘StarkEarly Orange’ F1 progeny. Tree Genetics & Genomes3, p. 299–309.Martinez-Gomez P., Dicente F., Audergon J-M., 2000.Behavior of apricot (Prunus armeniaca L.) cultivarsin the presence of sharka (plum pox potyvirus) : Areview. Agronomie-Paris 20, p. 407–422.Polák J., 1994. Breeding to resistance to plum poxpotyvirus in the Czech Republic. EPPO Bul 24, p.781–782.Polák J., Oukropec I., Komínek P., Krška B., BittóovaM., 1997. Detection and evaluation of resistance ofapricots and peaches to plum pox virus. J Plant DisProtection 104, p. 466–473.Ribaut J.M., Hoisington D., 1998. Marker-assistedselection: new tools and strategies. Trends Plant Sci3, p. 236–239Sicard O., Marandel G., Soriano J.M., Lalli D.A.,Lambert P., Salava J., Badenes M., Abbott A.,Decroocq V., 2007. Flanking the major Plum poxvirus resistance locus in apricot with co-dominantmarkers (SSRs) derived from candidate resistancegenes. Tree Genetics & Genomes DOI10.1007/s11295-007-0114-0.Vigouroux Y., McMullen M., Hittinger C.T., HouchinsK., Schulz L., Kresovich S., Matsuoka Y., DoebleyJ., 2002. Identifying genes of agronomic importancein maize by screening microsatellites for 416 TreeGenetics & Genomes (2008) 4, p. 403–417 evidenceof selection during domestication. Proc Natl Acad SciUSA 99:9650–965.Yang Z-N., Ye X-R., Molina J., Roose M.L., MirkovT.E., 2003. Sequence analysis of a 282-kilobaseregion surrounding the Citrus Tristeza Virusresistance gene (Ctv) locus in Poncircus trifoliate L.Raf. Plant Physiol 131, p. 482–492.180
Page 2:
SCIENTIFIC PAPERSSERIES B. HORTICUL
Page 5 and 6:
SCIENTIFIC COMMITTEE Bekir Erol AK
Page 7:
Fructification - Florin Constantin
Page 10:
Phenological Studies on Some Variet
Page 14:
Scientific Papers. Series B, Hortic
Page 17 and 18:
Table 2. The organoleptic appreciat
Page 19 and 20:
processes become even slower and th
Page 21 and 22:
- usingselectedbacteriafromm Leucon
Page 23 and 24:
To organoleptic analysis of the win
Page 25 and 26:
works were pickling the cucumbers i
Page 28 and 29:
Page 30 and 31:
days after removal of weeds by burn
Page 32:
it appears that the culture has gro
Page 35 and 36:
Maintainance of the genetic structu
Page 37 and 38:
Table 3. Interaction variety of dwa
Page 39 and 40:
Experimental scheme is situated in
Page 41 and 42:
improvement especially laboratory s
Page 43 and 44:
Table 1 shows the type 2x3x2 trifac
Page 45 and 46:
Neamtu G., Gheorghe Campeanu, Carme
Page 47 and 48:
Experience consisted of the followi
Page 49 and 50:
Table 7. Total production on plantV
Page 51 and 52:
vineyard, several methods were used
Page 53 and 54:
Table 4. Structure and number and r
Page 56 and 57:
Page 58 and 59:
gets serious role through the ferme
Page 60 and 61:
Table 3. Element content of the ber
Page 62 and 63:
Page 64 and 65:
Figure 4. The length of internodes
Page 66 and 67:
Page 68 and 69:
The process of fruit forming was de
Page 70 and 71:
Page 72 and 73:
Compomist F1 hybrid reaches value o
Page 74 and 75:
Page 76:
Figure 2. Experimental results repr
Page 79 and 80:
and total number of tubers per plan
Page 81 and 82:
and quality of organic potatoes for
Page 83 and 84:
Petri dishes, the pathogenic fungi
Page 85 and 86:
Variant 4R 2 11.0 4.0 15.0 7.0 22.0
Page 88 and 89:
Page 90 and 91:
Analyzing the dynamics of the total
Page 92 and 93:
Table 2. Indicative data on volumes
Page 94 and 95:
Page 96 and 97:
Table 3. The Influence of the level
Page 98 and 99:
Table 8. The Influence of irrigatio
Page 100 and 101:
Page 102 and 103:
Figure 1. The aspect of apples from
Page 104:
Conclusions on changes in chemicalc
Page 107 and 108:
RESULTS AND DISCUSSIONSRaspberry is
Page 109 and 110:
CONCLUSIONSAs a result of scientifi
Page 111 and 112:
observations were made on phenologi
Page 113 and 114:
Figure 1. Flowering period and blac
Page 116 and 117:
Page 118 and 119:
content, A-acidity content) to the
Page 120 and 121:
sugar accumulated in grapes and 1,0
Page 122 and 123:
Page 124 and 125:
Figure 2. DryerFigure 3. Programmer
Page 126 and 127:
Appearance of the apricots after 5
Page 128 and 129:
Page 130 and 131: where: P F represent the coordinate
Page 132 and 133: Scientific Papers. Series B, Hortic
Page 134 and 135: Table 2. The production obtained at
Page 136 and 137: As shown in figures 5 and 6 the vit
Page 140 and 141: At two weeks from planting it was a
Page 142 and 143: If we take into account the both fa
Page 146 and 147: F1 - + infectedF2 - + infectedF3 +
Page 148: HORTICULTURALBIODIVERSITY ANDGENETI
Page 151 and 152: RESULTS AND DISCUSSIONSFruit charac
Page 156 and 157: The chorology maps of Artemisia alb
Page 158 and 159: Figure 5. Chorology of Artemisia le
Page 162: Molecular differentiation showed a
Page 165 and 166: The characterization of the grapevi
Page 167 and 168: Figure 4. Amino acid profile of the
Page 169 and 170: Table 4. The significance of differ
Page 171 and 172: The studied phenophases (table 1),
Page 173 and 174: REFERENCESCapusan Janina, 2013. Rez
Page 175 and 176: Neoaliturus fenestratus Herrich-Sch
Page 177 and 178: occurrence in western part of Roman
Page 179: Pop 3 = Population 3 obtained by cr
Page 186 and 187: Variations in acidity of the variet
Page 188: grape. Analele Universitatii din Cr
Page 191 and 192: Flow cytometry has proved to be an
Page 193 and 194: cell nuclei, using chromosome count
Page 195 and 196: Figure 1. Prekos F1Figure 4. Prekos
Page 197 and 198: Interpretation of the results conce
Page 199 and 200: Photo 1- Redhaven (Control)The Roma
Page 201 and 202: Dry matter (determinate refractomet
Page 203 and 204: was evaluated by using a large-size
Page 208 and 209: During the growing season have been
Page 212 and 213: Likewise, vitamin C content of ‘G
Page 216 and 217: Figure 2. Air temperature (°C) in
Page 218: REFERENCESAnconelli S., Antolini G.
Page 221 and 222: Taking into the account these and t
Page 223 and 224: postharvest decays in fruits and ve
Page 225 and 226: manure semifermentated. In vegetati
Page 227 and 228: Figure 1. Prima Cl. 1022 varietyThe
Page 229 and 230: temperature required for a differen
Page 231 and 232:
MATERIALS AND METHODSTo accomplish
Page 233 and 234:
climate (IH4), becomes for this yea
Page 235 and 236:
quantities of sugar accumulated in
Page 237 and 238:
ibosomal to investigate 13 species
Page 239 and 240:
Biogeography of Genus MangiferaTwo
Page 241 and 242:
productionand uses. Center for trop
Page 243 and 244:
analysis of variance to express the
Page 245 and 246:
highlighted by a correlation coeffi
Page 247 and 248:
without heat and in open field. Cro
Page 249 and 250:
ut the fruit had a reduced number o
Page 251 and 252:
Genetic autochthonous heritage wasi
Page 253 and 254:
Table 1. The main characteristics o
Page 256 and 257:
Page 258 and 259:
Data were subjected to statistical
Page 260 and 261:
Also, the dry biomass and root leng
Page 262 and 263:
Page 264 and 265:
“Clapp’s Favorite” in 2011 wh
Page 266:
2012 the order was “Conference”
Page 269 and 270:
microspore to mature pollen, determ
Page 271 and 272:
microspores at certain date. Micros
Page 273 and 274:
viin utilizate ca genitori potentia
Page 275 and 276:
The objective of this paper, is to
Page 277 and 278:
Table 1. Relationship between germi
Page 280 and 281:
Page 282 and 283:
Figure 2. Tassels lengthIn case of
Page 284:
ORNAMENTAL PLANTS,DESIGN ANDLANDSCA
Page 287 and 288:
of Chisinau, also the old parks. Fo
Page 289 and 290:
y cambium on the very center - meth
Page 291 and 292:
flower is fully colored. Postharves
Page 293 and 294:
Results from table 8 shows that Mar
Page 296 and 297:
Page 298 and 299:
Pinus sylvestris ‘Gold Coin’, R
Page 300 and 301:
Page 302 and 303:
Figure 4. Excelsa (H 18/1)Descripti
Page 304 and 305:
Page 306 and 307:
Figure 1. Plants in cellular trays
Page 308:
espectively 69%, followed by hybrid
Page 311 and 312:
observations made on the plants of
Page 313 and 314:
The values of pH diminished in all
Page 315 and 316:
Figure 5. Content of total soluble
Page 317 and 318:
Figure 1. Plan of Bran domain (Ion
Page 319 and 320:
Carol the second, her brother, on h
Page 321 and 322:
Figure 14. Tea house in the natural
Page 323 and 324:
Cults, and in conformity with the c
Page 325 and 326:
consult the scientific novelties an
Page 327 and 328:
,,The restoration is the methodolog
Page 329 and 330:
MATERIALS AND METHODSThe chorology
Page 331 and 332:
Merce, 2011; Zamfirescu, 2010) (IAS
Page 334 and 335:
Page 336 and 337:
experiment because it shows and ill
Page 338:
among all the administrations, exce
Page 341 and 342:
solution known as AKN. Content: pot
Page 343 and 344:
As shown in the figure, Chrysal is
Page 346 and 347:
Page 348 and 349:
MotivationsOfferprospectingCustomer
Page 350:
conclude the presented case, with k
Page 353 and 354:
Also, comparative studies, concerni
Page 355 and 356:
done before. Also the speed of the
Page 357 and 358:
as Marcellus theatre or Trajan foru
Page 359 and 360:
ian regime, by huge contradictions
Page 361 and 362:
Pyongyang, the hidden cityThe capit
Page 363 and 364:
“ordinary” buildings as the gen
Page 365 and 366:
- The Writer’s Rotunda“The cons
Page 367 and 368:
Figure 4. Vegetation planRegarding
Page 369 and 370:
Figure 9. BenchesVasesThere are 4 k
Page 371 and 372:
REFERENCESPanoiu A., 2011, Evolutia
Page 373 and 374:
RESULTS AND DISCUSSIONSResults of t
Page 375 and 376:
Figure 5. Average growth rate of
Page 377 and 378:
In 2012 there were higher onset tem
Page 379 and 380:
fact that root injuries is the majo
Page 381 and 382:
We recommend that the species and c
Page 383 and 384:
and parameters of quality. The phys
Page 385 and 386:
AESTHETICALLEVEL OFAPPROACHLEVEL OF
Page 387 and 388:
REFERENCESArchibugi F., 1997. The E
Page 389 and 390:
Figure 1. Optimized version of comp
Page 391 and 392:
CONCLUSIONSThe optimized version (F
Page 394 and 395:
Page 396 and 397:
etween 182-212 g/l, the lowest valu
Page 398:
CONCLUSIONSThis study showed that 2
Page 401 and 402:
RESULTS AND DISCUSSIONSFor this pur
Page 403 and 404:
according to quality class.The calc
Page 405 and 406:
third party countries who wish to b
Page 407 and 408:
Stakeholder comments concerned nota
Page 409 and 410:
Figure 2. The „Eco-leaf” logo o
Page 411 and 412:
identified to facilitate its tracea
Page 413 and 414:
- Analysis reports;This document ma
Page 416 and 417:
Page 418 and 419:
Table 1. Sampling procedures applic
Page 420 and 421:
Table 2. Example of sampling proced
Page 422 and 423:
should be 5 kg.” According to thi
Page 424 and 425:
Page 426 and 427:
One of the first and simplest condi
Page 428 and 429:
of RIN transcription factor in ethy
Page 430 and 431:
Page 432 and 433:
oriented towards the centre of the
Page 434 and 435:
Figure 5. Macroscopic view of the c
Page 436 and 437:
Related to the process of the evolu
Page 438 and 439:
Page 440 and 441:
efore it is printed using the main
Page 442 and 443:
Imposition of the pot is done every
Page 444 and 445:
Figure 8. Test of Strength Vetiver
Page 446 and 447:
Page 448 and 449:
Table 3 defines LSD test for genoty
show all

Scientific Papers Series B Horticulture

Create successful ePaper yourself

Delete template?

Save as template?