Literatur Literatur Abdel-Latief, M., 2007. A family of chemoreceptors in Tribolium castaneum (Tenebrionidae: Coleoptera). PLoS One. 2, e1319. Abdel-Latief, M., Garbe, L. A., Koch, M. und Ruther, J., 2008. An epoxide hydrolase involved in the biosynthesis of an insect sex attractant and its use to localize the production site. Proc Natl Acad Sci U S A. 105, 8914-9. Abdelilah-Seyfried, S., Chan, Y. M., Zeng, C., Justice, N. J., Younger-Shepherd, S., Sharp, L. E., Barbel, S., Meadows, S. A., Jan, L. Y. und Jan, Y. N., 2000. A gain-of-function screen for genes that affect the development of the Drosophila adult external sensory organ. Genetics. 155, 733-52. Abubakar, M. S., Abdurahman, E. M. und Haruna, A. K., 2000. The repellant and antifeedant properties of Cyperus articulatus against Tribolium casteneum Hbst. Phytother Res. 14, 281-3. Abzhanov, A. und Kaufman, T. C., 1999. Homeotic genes and the arthropod head: expression patterns of the labial, proboscipedia, and Deformed genes in crustaceans and insects. Proc Natl Acad Sci U S A. 96, 10224-9. Adams, M. D., Celniker, S. E., Holt, R. A. et al., 2000. The genome sequence of Drosophila melanogaster. Science. 287, 2185-95. Adams, M. D. und Sekelsky, J. J., 2002. From sequence to phenotype: reverse genetics in Drosophila melanogaster. Nat Rev Genet. 3, 189-98. Agee, S. J., Lyons, D. C. und Weisblat, D. A., 2006. Maternal expression of a NANOS homolog is required for early development of the leech Helobdella robusta. Dev Biol. 298, 1-11. Alexandrea, M. K., Alina, T., Belinda, J. N., Bernard, M. D. und Sandie, M. D., 2010. Identifying the germline in an equally cleaving mollusc: Vasa and Nanos expression during embryonic and larval development of the vetigastropod Haliotis asinina. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution. 314/B, n/a. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. und Lipman, D. J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-402. Anderson, D. T., The development of hemimetabolous insects. In: Counce, S. J. and Waddington, C. H., Eds.), Developmental Systems: Insects, Vol. 1. Academic Press, London, New York, 1972a. Anderson, D. T., The development of holometabolous insects. In: Counce, S. J. and Waddington, C. H., Eds.), Developmental Systems: Insects, Vol. 1. Academic Press, London, New York, 1972b. Andreev, D., Kreitman, M., Phillips, T. W., Beeman, R. W. und ffrench-Constant, R. H., 1999. Multiple origins of cyclodiene insecticide resistance in Tribolium castaneum (Coleoptera: Tenebrionidae). J Mol Evol. 48, 615-24. Angelini, D. R. und Jockusch, E. L., 2008. Relationships among pest flour beetles of the genus Tribolium (Tenebrionidae) inferred from multiple molecular markers. Mol Phylogenet Evol. 46, 127-41. Aoki, Y., Nakamura, S., Ishikawa, Y. und Tanaka, M., 2009. Expression and syntenic analyses of four nanos genes in medaka. Zoolog Sci. 26, 112-8. Arakane, Y., Muthukrishnan, S., Kramer, K. J., Specht, C. A., Tomoyasu, Y., Lorenzen, M. D., Kanost, M. und Beeman, R. W., 2005. The Tribolium chitin synthase genes TcCHS1 and TcCHS2 are specialized for synthesis of epidermal cuticle and midgut peritrophic matrix. Insect Mol Biol. 14, 453-63. Arakane, Y., Specht, C. A., Kramer, K. J., Muthukrishnan, S. und Beeman, R. W., 2008. Chitin synthases are required for survival, fecundity and egg hatch in the red flour beetle, Tribolium castaneum. Insect Biochem Mol Biol. 38, 959-62. 242
Literatur Arama, E., Dickman, D., Kimchie, Z., Shearn, A. und Lev, Z., 2000. Mutations in the betapropeller domain of the Drosophila brain tumor (brat) protein induce neoplasm in the larval brain. Oncogene. 19, 3706-16. Aranda, M., Marques-Souza, H., Bayer, T. und Tautz, D., 2008. The role of the segmentation gene hairy in Tribolium. Dev Genes Evol. 218, 465-77. Arrizabalaga, G. und Lehmann, R., 1999. A selective screen reveals discrete functional domains in Drosophila Nanos. Genetics. 153, 1825-38. Asaoka, M., Sano, H., Obara, Y. und Kobayashi, S., 1998. Maternal Nanos regulates zygotic gene expression in germline progenitors of Drosophila melanogaster. Mech Dev. 78, 153-8. Asaoka-Taguchi, M., Yamada, M., Nakamura, A., Hanyu, K. und Kobayashi, S., 1999. Maternal Pumilio acts together with Nanos in germline development in Drosophila embryos. Nat Cell Biol. 1, 431-7. Baeg, G. H., Zhou, R. und Perrimon, N., 2005. Genome-wide RNAi analysis of JAK/STAT signaling components in Drosophila. Genes Dev. 19, 1861-70. Baker, N. E., 1988. Localization of transcripts from the wingless gene in whole Drosophila embryos. Development. 103, 289-98. Barker, D. D., Wang, C., Moore, J., Dickinson, L. K. und Lehmann, R., 1992. Pumilio is essential for function but not for distribution of the Drosophila abdominal determinant Nanos. Genes Dev. 6, 2312-26. Bate, M. und Martinez Arias, A., 1993. The development of Drosophila melanogaster, Vols. 1 and 2. The development of Drosophila melanogaster, Vols. 1 and 2. ix+812p.(vol. 2). Bäumer, D., Die Rolle von Tc-Spalt in der Entwicklung von Tribolium castaneum, Diplomarbeit, Abt. f. Entwicklungsbiologie, <strong>Friedrich</strong>-<strong>Alexander</strong>-<strong>Universität</strong> Beeman, R. W., 1987. A homeotic gene-cluster in the red flour beetle. Nature. 327, 247-249. Beeman, R. W. und Brown, S. J., 1999. RAPD-based genetic linkage maps of Tribolium castaneum. Genetics. 153, 333-8. Beeman, R. W., Stuart, J. J., Haas, M. S. und Denell, R. E., 1989. Genetic analysis of the homeotic gene complex (HOM-C) in the beetle Tribolium castaneum. Dev Biol. 133, 196- 209. Beeman, R. W., Stuart, J. J., Haas, M. S. und Friesen, K. S., 1996. Chromosome extraction and revision of linkage group 2 in Tribolium castaneum. J Hered. 87, 224-32. Beermann, A., Jay, D. G., Beeman, R. W., Hülskamp, M., Tautz, D. und Jurgens, G., 2001. The Short antennae gene of Tribolium is required for limb development and encodes the orthologue of the Drosophila Distal-less protein. Development. 128, 287-97. Beermann, A., Aranda, M. und Schröder, R., 2004. The Sp8 zinc-finger transcription factor is involved in allometric growth of the limbs in the beetle Tribolium castaneum. Development. 131, 733-42. Bennett, R. L., Brown, S. J. und Denell, R. E., 1999. Molecular and genetic analysis of the Tribolium Ultrabithorax ortholog, Ultrathorax. Dev Genes Evol. 209, 608-19. Berghammer, A., Keimbahntransformation mit universellem Marker und neue homöotische Gene in Tribolium castaneum., Dissertation, Fakultät Biologie, Ludwig-Maximilians- <strong>Universität</strong> Berghammer, A., Bucher, G., Maderspacher, F. und Klingler, M., 1999a. A system to efficiently maintain embryonic lethal mutations in the flour beetle Tribolium castaneum. Dev Genes Evol. 209, 382-9. Berghammer, A. J., Klingler, M. und Wimmer, E. A., 1999b. A universal marker for transgenic insects. Nature. 402, 370-1. Bergsten, S. E. und Gavis, E. R., 1999. Role for mRNA localization in translational activation but not spatial restriction of nanos RNA. Development. 126, 659-69. Bergsten, S. E., Huang, T., Chatterjee, S. und Gavis, E. R., 2001. Recognition and longrange interactions of a minimal nanos RNA localization signal element. Development. 128, 427-35. Berleth, T., Burri, M., Thoma, G., Bopp, D., Richstein, S., Frigerio, G., Noll, M. und Nüsslein- Volhard, C., 1988. The role of localization of bicoid RNA in organizing the anterior pattern of the Drosophila embryo. EMBO J. 7, 1749-56. 243
- Seite 1 und 2:
Die Funktion von Genen der posterio
- Seite 3:
Danke! Obwohl als letztes verfasst,
- Seite 6 und 7:
Inhaltsverzeichnis 2.4.1. Die Segme
- Seite 8 und 9:
Inhaltsverzeichnis 3.1.2. Die Auswe
- Seite 10 und 11:
Summary 2 Thus, I could show that a
- Seite 12 und 13:
Zusammenfassung praktischen Durchf
- Seite 14 und 15:
Abbildungsverzeichnis Abb. 24: Sche
- Seite 16 und 17:
Abkürzungen Abkürzungen 8 AS: Ami
- Seite 19 und 20:
Allgemeine Einleitung Allgemeine Ei
- Seite 21 und 22:
Allgemeine Einleitung Tiere, hervor
- Seite 23 und 24:
I. Kapitel: I. 1. Einleitung Die Fu
- Seite 25 und 26:
I. 1. Einleitung 3; Davis und Patel
- Seite 27 und 28:
I. 1. Einleitung 1.2. Drosophila me
- Seite 29 und 30:
I. 1. Einleitung Butler, 1988). Int
- Seite 31 und 32:
I. 1. Einleitung zur Phosphorylieru
- Seite 33 und 34:
I. 1. Einleitung Gene ist in Tribol
- Seite 35 und 36:
I. 1. Einleitung Die frühe Regulat
- Seite 37 und 38:
I. 1. Einleitung wahrscheinlich üb
- Seite 39 und 40:
I. 1. Einleitung wie in Vertebraten
- Seite 41 und 42:
I. 1. Einleitung und Wharton, 1999)
- Seite 43 und 44:
I. 1. Einleitung des nanos-Verlusts
- Seite 45 und 46:
I. 1. Einleitung Außerdem zeigen n
- Seite 47 und 48:
1.5. Ziele des ersten Kapitels der
- Seite 49 und 50:
2. Ergebnisse I. 2. Ergebnisse 2.1.
- Seite 51 und 52:
I. 2. Ergebnisse Abb. 6: Sequenzver
- Seite 53 und 54:
I. 2. Ergebnisse Domäne vermittelt
- Seite 55 und 56:
2.2.2. nanos-Expression ist nur in
- Seite 57 und 58:
I. 2. Ergebnisse 2.3. pRNAi für na
- Seite 59 und 60:
I. 2. Ergebnisse einerseits, dass d
- Seite 61 und 62:
I. 2. Ergebnisse des Kopfes. Außer
- Seite 63 und 64:
I. 2. Ergebnisse Doppel-RNAi in ver
- Seite 65 und 66:
I. 2. Ergebnisse 2.4. Frühembryona
- Seite 67 und 68:
I. 2. Ergebnisse nächst ist zu beo
- Seite 69 und 70:
I. 2. Ergebnisse 61
- Seite 71 und 72:
I. 2. Ergebnisse Domäne. Diese ble
- Seite 73 und 74:
I. 2. Ergebnisse 65
- Seite 75 und 76:
I. 2. Ergebnisse terminaler Zielgen
- Seite 77 und 78:
I. 2. Ergebnisse Tatsächlich fehle
- Seite 79 und 80:
I. 2. Ergebnisse Abb. 15: nos/pum-R
- Seite 81 und 82:
I. 2. Ergebnisse Expression auf die
- Seite 83 und 84:
I. 2. Ergebnisse 2.7. Die Beteiligu
- Seite 85 und 86:
2.7.1. Tribolium brain-tumor I. 2.
- Seite 87 und 88:
I. 2. Ergebnisse 2.7.3. brat-RNAi f
- Seite 89 und 90:
I. 2. Ergebnisse kulas somit interm
- Seite 91 und 92:
Abb. 19: brain-tumor-RNAi führt zu
- Seite 93 und 94:
I. 2. Ergebnisse Keimbahn in Verbin
- Seite 95 und 96:
I. 2. Ergebnisse 2.8.3. pumilio spi
- Seite 97 und 98:
I. 2. Ergebnisse Präpuppe, deren M
- Seite 99 und 100:
3. Diskussion I. 3. Diskussion 3.1.
- Seite 101 und 102:
I. 3. Diskussion mann, 1998; Asaoka
- Seite 103 und 104:
I. 3. Diskussion leider nicht gepr
- Seite 105 und 106:
I. 3. Diskussion Möglicherweise ve
- Seite 107 und 108:
I. 3. Diskussion Marques-Souza et a
- Seite 109 und 110:
I. 3. Diskussion der antennalen Seg
- Seite 111 und 112:
I. 3. Diskussion Effekt, der erst i
- Seite 113 und 114:
I. 3. Diskussion Netzwerk, das zur
- Seite 115 und 116:
I. 3. Diskussion gerufene Vernetzun
- Seite 117 und 118:
I. 3. Diskussion Natürlich gibt es
- Seite 119 und 120:
I. 3. Diskussion 3.4. Das Zusammens
- Seite 121 und 122:
I. 3. Diskussion sion als Substrat
- Seite 123 und 124:
I. 3. Diskussion ren gt-Domäne üb
- Seite 125 und 126:
I. 3. Diskussion Außerdem hat otd-
- Seite 127 und 128:
I. 3. Diskussion on eines von Fakto
- Seite 129 und 130:
I. 3. Diskussion jeweiligen ersten
- Seite 131 und 132:
4. Material und Methoden I. 4. Mate
- Seite 133 und 134:
4.2.1. in situ Hybridisierung I. 4.
- Seite 135 und 136:
I. 4. Material und Methoden ohne Bl
- Seite 137:
Tab. 6: Primer für dsRNA Matrize I
- Seite 140 und 141:
II. 1. Einleitung 132 In Anlehnung
- Seite 142 und 143:
II. 1. Einleitung Entwicklung. Dabe
- Seite 144 und 145:
II. 1. Einleitung 1.3. RNAi-Screens
- Seite 146 und 147:
II. 1. Einleitung Serie zu beobacht
- Seite 148 und 149:
II. 1. Einleitung 140 schen Fragest
- Seite 150 und 151:
II. 1. Einleitung Augen und im zent
- Seite 152 und 153:
II. 1. Einleitung 1.4.3. Die iBeetl
- Seite 154 und 155:
II. 1. Einleitung sophila wegen tec
- Seite 156 und 157:
II. 1. Einleitung 1.5. Ziele des zw
- Seite 158 und 159:
II. 2. Ergebnisse nale Musterbildun
- Seite 160 und 161:
II. 2. Ergebnisse 152 Im nächsten
- Seite 162 und 163:
II. 2. Ergebnisse bei 30°C inkubie
- Seite 164 und 165:
II. 2. Ergebnisse 1999a) 156 Auch d
- Seite 166 und 167:
II. 2. Ergebnisse lichst effektiv z
- Seite 168 und 169:
II. 2. Ergebnisse 160
- Seite 170 und 171:
II. 2. Ergebnisse 162
- Seite 172 und 173:
II. 2. Ergebnisse Abb. 29: Arbeitsp
- Seite 174 und 175:
II. 2. Ergebnisse Ergebnisse der Po
- Seite 176 und 177:
II. 2. Ergebnisse von RNAi-Effekten
- Seite 178 und 179:
II. 2. Ergebnisse 2.3. Es konnten f
- Seite 180 und 181:
II. 2. Ergebnisse Abb. 32: Zusammen
- Seite 182 und 183:
II. 2. Ergebnisse Abb. 33: Defekte
- Seite 184 und 185:
II. 2. Ergebnisse zu trennen. So k
- Seite 186 und 187:
II. 2. Ergebnisse 2.3.2. Defekte w
- Seite 188 und 189:
II. 2. Ergebnisse Abb. 35: Morpholo
- Seite 190 und 191:
II. 2. Ergebnisse diesen Phänotype
- Seite 192 und 193:
II. 2. Ergebnisse 184
- Seite 194 und 195:
II. 2. Ergebnisse Abb. 37: In adult
- Seite 196 und 197:
II. 2. Ergebnisse Abb. 38: Bisher u
- Seite 198 und 199:
II. 3. Diskussion des ersten Jahres
- Seite 200 und 201: II. 3. Diskussion analysiert werden
- Seite 202 und 203: II. 3. Diskussion Meinung, dass der
- Seite 204 und 205: II. 3. Diskussion jeweils zu Beginn
- Seite 206 und 207: II. 3. Diskussion nach den gleichen
- Seite 208 und 209: II. 3. Diskussion in Tribolium, nic
- Seite 210 und 211: II. 3. Diskussion 1980). Bei der Ka
- Seite 212 und 213: II. 3. Diskussion phänotypische Hi
- Seite 214 und 215: II. 3. Diskussion 3.2.6. iBeetle ha
- Seite 216 und 217: II. 3. Diskussion Prozesse der Inse
- Seite 218 und 219: II. 4. Material und Methoden Phenol
- Seite 220 und 221: II. 4. Material und Methoden pigmen
- Seite 222 und 223: II. 4. Material und Methoden 214 Em
- Seite 224 und 225: II. 4. Material und Methoden bei de
- Seite 226 und 227: II. 4. Material und Methoden 218 Ti
- Seite 229 und 230: Allgemeine Diskussion Allgemeine Di
- Seite 231: Allgemeine Diskussion und Achsendet
- Seite 234 und 235: Anhang ACCCATCCGTACGGCTGCCGGGTCATTC
- Seite 236 und 237: Anhang 2. Ergänzende Ergebnisse zu
- Seite 238 und 239: Anhang 3. Zeitaufwand der iBeetle-A
- Seite 240 und 241: Anhang 5. Zusammenfassung der Ergeb
- Seite 242 und 243: 234 134 900 14 similar to D123 (cdc
- Seite 244 und 245: 236 77 1500 57 gene without homolog
- Seite 246 und 247: 238 43 1000 99 similar to Rab-prote
- Seite 248 und 249: Anhang gemischt embryonal letal von
- Seite 252 und 253: Literatur Bernstein, D., Hook, B.,
- Seite 254 und 255: Literatur Ciglar, L. und Furlong, E
- Seite 256 und 257: Literatur Falciani, F., Hausdorf, B
- Seite 258 und 259: Literatur Gutjahr, T., Vanario-Alon
- Seite 260 und 261: Literatur Kiger, A. A., Baum, B., J
- Seite 262 und 263: Literatur Lin, H. und Spradling, A.
- Seite 264 und 265: Literatur binding protein that phys
- Seite 266 und 267: Literatur Riddiford, L. M., Hiruma,
- Seite 268 und 269: Literatur Schüpbach, T. und Wiesch
- Seite 270 und 271: Literatur Tomoyasu, Y., Miller, S.
- Seite 272: Literatur Zhang, X. D. und Heyse, J