Literatur binding protein that physically interacts with a Nanos homolog, Xcat-2, and a cytoplasmic polyadenylation element-binding protein. J Biol Chem. 276, 20945-53. Nakahata, S., Kotani, T., Mita, K., Kawasaki, T., Katsu, Y., Nagahama, Y. und Yamashita, M., 2003. Involvement of Xenopus Pumilio in the translational regulation that is specific to cyclin B1 mRNA during oocyte maturation. Mech Dev. 120, 865-80. Nakao, H., Matsumoto, T., Oba, Y., Niimi, T. und Yaginuma, T., 2008. Germ cell specification and early embryonic patterning in Bombyx mori as revealed by nanos orthologues. Evol Dev. 10, 546-54. Nauber, U., Pankratz, M. J., Kienlin, A., Seifert, E., Klemm, U. und Jäckle, H., 1988. Abdominal segmentation of the Drosophila embryo requires a hormone receptor-like protein encoded by the gap gene knirps. Nature. 336, 489-92. Neely, G. G., Kuba, K., Cammarato, A. et al., 2010. A global in vivo Drosophila RNAi screen identifies NOT3 as a conserved regulator of heart function. Cell. 141, 142-53. Nie, W., Stronach, B., Panganiban, G., Shippy, T., Brown, S. und Denell, R., 2001. Molecular characterization of Tclabial and the 3' end of the Tribolium homeotic complex. Dev Genes Evol. 211, 244-51. Niessing, D., Rivera-Pomar, R., La Rosee, A., Hader, T., Schock, F., Purnell, B. A. und Jäckle, H., 1997. A cascade of transcriptional control leading to axis determination in Drosophila. J Cell Physiol. 173, 162-7. Nilson, L. A. und Schupbach, T., 1998. Localized requirements for windbeutel and pipe reveal a dorsoventral prepattern within the follicular epithelium of the Drosophila ovary. Cell. 93, 253-62. Nolde, M. J., Saka, N., Reinert, K. L. und Slack, F. J., 2007. The Caenorhabditis elegans pumilio homolog, puf-9, is required for the 3'UTR-mediated repression of the let-7 microRNA target gene, hbl-1. Dev Biol. 305, 551-63. Nunes da Fonseca, R., von Levetzow, C., Kalscheuer, P., Basal, A., van der Zee, M. und Roth, S., 2008. Self-regulatory circuits in dorsoventral axis formation of the short-germ beetle Tribolium castaneum. Dev Cell. 14, 605-15. Nüsslein-Volhard, C., 1994. Of flies and fishes. Science. 266, 572-4. Nüsslein-Volhard, C., Frohnhofer, H. G. und Lehmann, R., 1987. Determination of anteroposterior polarity in Drosophila. Science. 238, 1675-81. Nüsslein-Volhard, C. und Wieschaus, E., 1980. Mutations affecting segment number and polarity in Drosophila. Nature. 287, 795-801. Olesnicky, E. C. und Desplan, C., 2007. Distinct mechanisms for mRNA localization during embryonic axis specification in the wasp Nasonia. Dev Biol. 306, 134-42. Olivas, W. und Parker, R., 2000. The Puf3 protein is a transcript-specific regulator of mRNA degradation in yeast. EMBO J. 19, 6602-11. Orlando, V., 2000. Mapping chromosomal proteins in vivo by formaldehyde-crosslinkedchromatin immunoprecipitation. Trends in Biochemical Sciences. 25, 99-104. Oro, A. E., Ong, E. S., Margolis, J. S., Posakony, J. W., McKeown, M. und Evans, R. M., 1988. The Drosophila gene knirps-related is a member of the steroid-receptor gene superfamily. Nature. 336, 493-6. Panfilio, K. A., 2008. Extraembryonic development in insects and the acrobatics of blastokinesis. Dev Biol. 313, 471-91. Pankratz, M. J. und Jäckle, H., 1990. Making stripes in the Drosophila embryo. Trends Genet. 6, 287-92. Parisi, M. und Lin, H., 1999. The Drosophila pumilio gene encodes two functional protein isoforms that play multiple roles in germline development, gonadogenesis, oogenesis and embryogenesis. Genetics. 153, 235-50. Park, Y., Aikins, J., Wang, L. J., Beeman, R. W., Oppert, B., Lord, J. C., Brown, S. J., Lorenzen, M. D., Richards, S., Weinstock, G. M. und Gibbs, R. A., 2008. Analysis of transcriptome data in the red flour beetle, Tribolium castaneum. Insect Biochem Mol Biol. 38, 380-6. Paroush, Z., Wainwright, S. M. und Ish-Horowicz, D., 1997. Torso signalling regulates terminal patterning in Drosophila by antagonising Groucho-mediated repression. Development. 124, 3827-34. 256
Literatur Parthasarathy, R., Tan, A., Bai, H. und Palli, S. R., 2008a. Transcription factor broad suppresses precocious development of adult structures during larval-pupal metamorphosis in the red flour beetle, Tribolium castaneum. Mech Dev. 125, 299-313. Parthasarathy, R., Tan, A. und Palli, S. R., 2008b. bHLH-PAS family transcription factor methoprene-tolerant plays a key role in JH action in preventing the premature development of adult structures during larval-pupal metamorphosis. Mech Dev. 125, 601-16. Patel, N. H., Condron, B. G. und Zinn, K., 1994. Pair-rule expression patterns of evenskipped are found in both short- and long-germ beetles. Nature. 367, 429-34. Patel, N. H., Hayward, D. C., Lall, S., Pirkl, N. R., DiPietro, D. und Ball, E. E., 2001. Grasshopper hunchback expression reveals conserved and novel aspects of axis formation and segmentation. Development. 128, 3459-72. Patel, N. H., Kornberg, T. B. und Goodman, C. S., 1989. Expression of engrailed during segmentation in grasshopper and crayfish. Development. 107, 201-12. Patton, E. E. und Zon, L. I., 2001. The art and design of genetic screens: Zebrafish. Nature Reviews Genetics. 2, 956-966. Pavlopoulos, A., Berghammer, A. J., Averof, M. und Klingler, M., 2004. Efficient transformation of the beetle Tribolium castaneum using the Minos transposable element: quantitative and qualitative analysis of genomic integration events. Genetics. 167, 737-46. Payre, F., 2004. Genetic control of epidermis differentiation in Drosophila. Int J Dev Biol. 48, 207-15. Peel, A. D., 2008. The evolution of developmental gene networks: lessons from comparative studies on holometabolous insects. Philos Trans R Soc Lond B Biol Sci. 363, 1539-47. Peel, A. D., Chipman, A. D. und Akam, M., 2005. Arthropod segmentation: beyond the Drosophila paradigm. Nat Rev Genet. 6, 905-16. Peri, F., Technau, M. und Roth, S., 2002. Mechanisms of Gurken-dependent pipe regulation and the robustness of dorsoventral patterning in Drosophila. Development. 129, 2965- 75. Petavy, G., 1986. Contribution Of The Vitellophags To Yolk Digestion And Cytophagocytosis During Embryogenesis Of The Migratory Locust, Locusta-Migratoria L (Orthoptera, Acrididae). International Journal of Insect Morphology & Embryology. 15, 343-361. Peterson, T. M., 2007. Motivation: How to increase project team performance. Project Management Journal. 38, 60-69. Pilon, M. und Weisblat, D. A., 1997. A nanos homolog in leech. Development. 124, 1771-80. Pique, M., Lopez, J. M., Foissac, S., Guigo, R. und Mendez, R., 2008. A combinatorial code for CPE-mediated translational control. Cell. 132, 434-48. Pollock, D. D. und Larkin, J. C., 2004. Estimating the degree of saturation in mutant screens. Genetics. 168, 489-502. Posnien, N., Bashasab, F. und Bucher, G., 2009. The insect upper lip (labrum) is a nonsegmental appendage-like structure. Evol Dev. 11, 480-8. Posnien, N. und Bucher, G., 2009. Formation of the insect head involves lateral contribution of the intercalary segment, which depends on Tc-labial function. Dev Biol. Prpic, N. M., Wigand, B., Damen, W. G. und Klingler, M., 2001. Expression of dachshund in wild-type and Distal-less mutant Tribolium corroborates serial homologies in insect appendages. Dev Genes Evol. 211, 467-77. Pultz, M. A., Westendorf, L., Gale, S. D., Hawkins, K., Lynch, J., Pitt, J. N., Reeves, N. L., Yao, J. C., Small, S., Desplan, C. und Leaf, D. S., 2005. A major role for zygotic hunchback in patterning the Nasonia embryo. Development. 132, 3705-15. Rabinowitz, J. S., Chan, X. Y., Kingsley, E. P., Duan, Y. und Lambert, J. D., 2008. Nanos is required in somatic blast cell lineages in the posterior of a mollusk embryo. Curr Biol. 18, 331-6. Rana, T. M., 2007. Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev Mol Cell Biol. 8, 23-36. Reinitz, J. und Sharp, D. H., 1995. Mechanism of eve stripe formation. Mech Dev. 49, 133- 58. 257
- Seite 1 und 2:
Die Funktion von Genen der posterio
- Seite 3:
Danke! Obwohl als letztes verfasst,
- Seite 6 und 7:
Inhaltsverzeichnis 2.4.1. Die Segme
- Seite 8 und 9:
Inhaltsverzeichnis 3.1.2. Die Auswe
- Seite 10 und 11:
Summary 2 Thus, I could show that a
- Seite 12 und 13:
Zusammenfassung praktischen Durchf
- Seite 14 und 15:
Abbildungsverzeichnis Abb. 24: Sche
- Seite 16 und 17:
Abkürzungen Abkürzungen 8 AS: Ami
- Seite 19 und 20:
Allgemeine Einleitung Allgemeine Ei
- Seite 21 und 22:
Allgemeine Einleitung Tiere, hervor
- Seite 23 und 24:
I. Kapitel: I. 1. Einleitung Die Fu
- Seite 25 und 26:
I. 1. Einleitung 3; Davis und Patel
- Seite 27 und 28:
I. 1. Einleitung 1.2. Drosophila me
- Seite 29 und 30:
I. 1. Einleitung Butler, 1988). Int
- Seite 31 und 32:
I. 1. Einleitung zur Phosphorylieru
- Seite 33 und 34:
I. 1. Einleitung Gene ist in Tribol
- Seite 35 und 36:
I. 1. Einleitung Die frühe Regulat
- Seite 37 und 38:
I. 1. Einleitung wahrscheinlich üb
- Seite 39 und 40:
I. 1. Einleitung wie in Vertebraten
- Seite 41 und 42:
I. 1. Einleitung und Wharton, 1999)
- Seite 43 und 44:
I. 1. Einleitung des nanos-Verlusts
- Seite 45 und 46:
I. 1. Einleitung Außerdem zeigen n
- Seite 47 und 48:
1.5. Ziele des ersten Kapitels der
- Seite 49 und 50:
2. Ergebnisse I. 2. Ergebnisse 2.1.
- Seite 51 und 52:
I. 2. Ergebnisse Abb. 6: Sequenzver
- Seite 53 und 54:
I. 2. Ergebnisse Domäne vermittelt
- Seite 55 und 56:
2.2.2. nanos-Expression ist nur in
- Seite 57 und 58:
I. 2. Ergebnisse 2.3. pRNAi für na
- Seite 59 und 60:
I. 2. Ergebnisse einerseits, dass d
- Seite 61 und 62:
I. 2. Ergebnisse des Kopfes. Außer
- Seite 63 und 64:
I. 2. Ergebnisse Doppel-RNAi in ver
- Seite 65 und 66:
I. 2. Ergebnisse 2.4. Frühembryona
- Seite 67 und 68:
I. 2. Ergebnisse nächst ist zu beo
- Seite 69 und 70:
I. 2. Ergebnisse 61
- Seite 71 und 72:
I. 2. Ergebnisse Domäne. Diese ble
- Seite 73 und 74:
I. 2. Ergebnisse 65
- Seite 75 und 76:
I. 2. Ergebnisse terminaler Zielgen
- Seite 77 und 78:
I. 2. Ergebnisse Tatsächlich fehle
- Seite 79 und 80:
I. 2. Ergebnisse Abb. 15: nos/pum-R
- Seite 81 und 82:
I. 2. Ergebnisse Expression auf die
- Seite 83 und 84:
I. 2. Ergebnisse 2.7. Die Beteiligu
- Seite 85 und 86:
2.7.1. Tribolium brain-tumor I. 2.
- Seite 87 und 88:
I. 2. Ergebnisse 2.7.3. brat-RNAi f
- Seite 89 und 90:
I. 2. Ergebnisse kulas somit interm
- Seite 91 und 92:
Abb. 19: brain-tumor-RNAi führt zu
- Seite 93 und 94:
I. 2. Ergebnisse Keimbahn in Verbin
- Seite 95 und 96:
I. 2. Ergebnisse 2.8.3. pumilio spi
- Seite 97 und 98:
I. 2. Ergebnisse Präpuppe, deren M
- Seite 99 und 100:
3. Diskussion I. 3. Diskussion 3.1.
- Seite 101 und 102:
I. 3. Diskussion mann, 1998; Asaoka
- Seite 103 und 104:
I. 3. Diskussion leider nicht gepr
- Seite 105 und 106:
I. 3. Diskussion Möglicherweise ve
- Seite 107 und 108:
I. 3. Diskussion Marques-Souza et a
- Seite 109 und 110:
I. 3. Diskussion der antennalen Seg
- Seite 111 und 112:
I. 3. Diskussion Effekt, der erst i
- Seite 113 und 114:
I. 3. Diskussion Netzwerk, das zur
- Seite 115 und 116:
I. 3. Diskussion gerufene Vernetzun
- Seite 117 und 118:
I. 3. Diskussion Natürlich gibt es
- Seite 119 und 120:
I. 3. Diskussion 3.4. Das Zusammens
- Seite 121 und 122:
I. 3. Diskussion sion als Substrat
- Seite 123 und 124:
I. 3. Diskussion ren gt-Domäne üb
- Seite 125 und 126:
I. 3. Diskussion Außerdem hat otd-
- Seite 127 und 128:
I. 3. Diskussion on eines von Fakto
- Seite 129 und 130:
I. 3. Diskussion jeweiligen ersten
- Seite 131 und 132:
4. Material und Methoden I. 4. Mate
- Seite 133 und 134:
4.2.1. in situ Hybridisierung I. 4.
- Seite 135 und 136:
I. 4. Material und Methoden ohne Bl
- Seite 137:
Tab. 6: Primer für dsRNA Matrize I
- Seite 140 und 141:
II. 1. Einleitung 132 In Anlehnung
- Seite 142 und 143:
II. 1. Einleitung Entwicklung. Dabe
- Seite 144 und 145:
II. 1. Einleitung 1.3. RNAi-Screens
- Seite 146 und 147:
II. 1. Einleitung Serie zu beobacht
- Seite 148 und 149:
II. 1. Einleitung 140 schen Fragest
- Seite 150 und 151:
II. 1. Einleitung Augen und im zent
- Seite 152 und 153:
II. 1. Einleitung 1.4.3. Die iBeetl
- Seite 154 und 155:
II. 1. Einleitung sophila wegen tec
- Seite 156 und 157:
II. 1. Einleitung 1.5. Ziele des zw
- Seite 158 und 159:
II. 2. Ergebnisse nale Musterbildun
- Seite 160 und 161:
II. 2. Ergebnisse 152 Im nächsten
- Seite 162 und 163:
II. 2. Ergebnisse bei 30°C inkubie
- Seite 164 und 165:
II. 2. Ergebnisse 1999a) 156 Auch d
- Seite 166 und 167:
II. 2. Ergebnisse lichst effektiv z
- Seite 168 und 169:
II. 2. Ergebnisse 160
- Seite 170 und 171:
II. 2. Ergebnisse 162
- Seite 172 und 173:
II. 2. Ergebnisse Abb. 29: Arbeitsp
- Seite 174 und 175:
II. 2. Ergebnisse Ergebnisse der Po
- Seite 176 und 177:
II. 2. Ergebnisse von RNAi-Effekten
- Seite 178 und 179:
II. 2. Ergebnisse 2.3. Es konnten f
- Seite 180 und 181:
II. 2. Ergebnisse Abb. 32: Zusammen
- Seite 182 und 183:
II. 2. Ergebnisse Abb. 33: Defekte
- Seite 184 und 185:
II. 2. Ergebnisse zu trennen. So k
- Seite 186 und 187:
II. 2. Ergebnisse 2.3.2. Defekte w
- Seite 188 und 189:
II. 2. Ergebnisse Abb. 35: Morpholo
- Seite 190 und 191:
II. 2. Ergebnisse diesen Phänotype
- Seite 192 und 193:
II. 2. Ergebnisse 184
- Seite 194 und 195:
II. 2. Ergebnisse Abb. 37: In adult
- Seite 196 und 197:
II. 2. Ergebnisse Abb. 38: Bisher u
- Seite 198 und 199:
II. 3. Diskussion des ersten Jahres
- Seite 200 und 201:
II. 3. Diskussion analysiert werden
- Seite 202 und 203:
II. 3. Diskussion Meinung, dass der
- Seite 204 und 205:
II. 3. Diskussion jeweils zu Beginn
- Seite 206 und 207:
II. 3. Diskussion nach den gleichen
- Seite 208 und 209:
II. 3. Diskussion in Tribolium, nic
- Seite 210 und 211:
II. 3. Diskussion 1980). Bei der Ka
- Seite 212 und 213:
II. 3. Diskussion phänotypische Hi
- Seite 214 und 215: II. 3. Diskussion 3.2.6. iBeetle ha
- Seite 216 und 217: II. 3. Diskussion Prozesse der Inse
- Seite 218 und 219: II. 4. Material und Methoden Phenol
- Seite 220 und 221: II. 4. Material und Methoden pigmen
- Seite 222 und 223: II. 4. Material und Methoden 214 Em
- Seite 224 und 225: II. 4. Material und Methoden bei de
- Seite 226 und 227: II. 4. Material und Methoden 218 Ti
- Seite 229 und 230: Allgemeine Diskussion Allgemeine Di
- Seite 231: Allgemeine Diskussion und Achsendet
- Seite 234 und 235: Anhang ACCCATCCGTACGGCTGCCGGGTCATTC
- Seite 236 und 237: Anhang 2. Ergänzende Ergebnisse zu
- Seite 238 und 239: Anhang 3. Zeitaufwand der iBeetle-A
- Seite 240 und 241: Anhang 5. Zusammenfassung der Ergeb
- Seite 242 und 243: 234 134 900 14 similar to D123 (cdc
- Seite 244 und 245: 236 77 1500 57 gene without homolog
- Seite 246 und 247: 238 43 1000 99 similar to Rab-prote
- Seite 248 und 249: Anhang gemischt embryonal letal von
- Seite 250 und 251: Literatur Literatur Abdel-Latief, M
- Seite 252 und 253: Literatur Bernstein, D., Hook, B.,
- Seite 254 und 255: Literatur Ciglar, L. und Furlong, E
- Seite 256 und 257: Literatur Falciani, F., Hausdorf, B
- Seite 258 und 259: Literatur Gutjahr, T., Vanario-Alon
- Seite 260 und 261: Literatur Kiger, A. A., Baum, B., J
- Seite 262 und 263: Literatur Lin, H. und Spradling, A.
- Seite 266 und 267: Literatur Riddiford, L. M., Hiruma,
- Seite 268 und 269: Literatur Schüpbach, T. und Wiesch
- Seite 270 und 271: Literatur Tomoyasu, Y., Miller, S.
- Seite 272: Literatur Zhang, X. D. und Heyse, J