Literatur Tomoyasu, Y., Miller, S. C., Tomita, S., Schoppmeier, M., Grossmann, D. und Bucher, G., 2008. Exploring systemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium. Genome Biol. 9, R10. Tomoyasu, Y., Wheeler, S. R. und Denell, R. E., 2005. Ultrabithorax is required for membranous wing identity in the beetle Tribolium castaneum. Nature. 433, 643-7. Torras, R. und Gonzalez-Crespo, S., 2005. Posterior expression of nanos orthologs during embryonic and larval development of the anthozoan Nematostella vectensis. Int J Dev Biol. 49, 895-9. Torras, R., Yanze, N., Schmid, V. und Gonzalez-Crespo, S., 2004. nanos expression at the embryonic posterior pole and the medusa phase in the hydrozoan Podocoryne carnea. Evol Dev. 6, 362-71. Trauner, J., Analyse der Oogenese und Insertionsmutagenese in Tribolium castaneum, Dissertation, Developmental Biology, <strong>Friedrich</strong>-<strong>Alexander</strong>-<strong>Universität</strong> Trauner, J. und Büning, J., 2007. Germ-cell cluster formation in the telotrophic meroistic ovary of Tribolium castaneum (Coleoptera, Polyphaga, Tenebrionidae) and its implication on insect phylogeny. Dev Genes Evol. 217, 13-27. Trauner, J., Schinko, J., Lorenzen, M. D., Shippy, T. D., Wimmer, E. A., Beeman, R. W., Klingler, M., Bucher, G. und Brown, S. J., 2009. Large-scale insertional mutagenesis of a coleopteran stored grain pest, the red flour beetle Tribolium castaneum, identifies embryonic lethal mutations and enhancer traps. BMC Biol. 7, 73. Tribolium Genome Sequencing Consortium, 2008. The genome of the model beetle and pest Tribolium castaneum. Nature. 452, 949-55. Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K., Haraguchi, S., Kobayashi, S. und Saga, Y., 2003. Conserved role of nanos proteins in germ cell development. Science. 301, 1239-41. Turner, F. R. und Mahowald, A. P., 1977. Scanning electron microscopy of Drosophila melanogaster embryogenesis. II. Gastrulation and segmentation. Dev Biol. 57, 403-16. van der Zee, M., Berns, N. und Roth, S., 2005. Distinct functions of the Tribolium zerknullt genes in serosa specification and dorsal closure. Curr Biol. 15, 624-36. van der Zee, M., Stockhammer, O., von Levetzow, C., Nunes da Fonseca, R. und Roth, S., 2006. Sog/Chordin is required for ventral-to-dorsal Dpp/BMP transport and head formation in a short germ insect. Proc Natl Acad Sci U S A. 103, 16307-12. van Eeden, F. und St Johnston, D., 1999. The polarisation of the anterior-posterior and dorsal-ventral axes during Drosophila oogenesis. Curr Opin Genet Dev. 9, 396-404. Verrotti, A. C. und Wharton, R. P., 2000. Nanos interacts with cup in the female germline of Drosophila. Development. 127, 5225-32. Walser, C. B., Battu, G., Hoier, E. F. und Hajnal, A., 2006. Distinct roles of the Pumilio and FBF translational repressors during C. elegans vulval development. Development. 133, 3461-71. Wang, C., Dickinson, L. K. und Lehmann, R., 1994. Genetics of nanos localization in Drosophila. Dev Dyn. 199, 103-15. Wang, C. und Lehmann, R., 1991. Nanos is the localized posterior determinant in Drosophila. Cell. 66, 637-47. Wang, X., McLachlan, J., Zamore, P. D. und Hall, T. M., 2002. Modular recognition of RNA by a human pumilio-homology domain. Cell. 110, 501-12. Wang, X., Zamore, P. D. und Hall, T. M., 2001. Crystal structure of a Pumilio homology domain. Mol Cell. 7, 855-65. Wang, Y., Zayas, R. M., Guo, T. und Newmark, P. A., 2007. nanos function is essential for development and regeneration of planarian germ cells. Proc Natl Acad Sci U S A. 104, 5901-6. Wang, Y. M., Opperman, L., Wickens, M. und Hall, T. M. T., 2009. Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein. Proceedings of the National Academy of Sciences of the United States of America. 106, 20186-20191. Wang, Z. und Lin, H., 2004. Nanos maintains germline stem cell self-renewal by preventing differentiation. Science. 303, 2016-9. 262
Literatur Warchalewski, J. R., Pradzynska, A., Gralik, J. und Nawrot, J., 2000. The effect of gamma and microwave irradiation of wheat grain on development parameters of some stored grain pests. Nahrung. 44, 411-4. Waterhouse, P. M., Wang, M. B. und Lough, T., 2001. Gene silencing as an adaptive defence against viruses. Nature. 411, 834-42. Weigel, D., Jurgens, G., Klingler, M. und Jäckle, H., 1990. Two gap genes mediate maternal terminal pattern information in Drosophila. Science. 248, 495-8. Weil, T. T., Forrest, K. M. und Gavis, E. R., 2006. Localization of bicoid mRNA in late oocytes is maintained by continual active transport. Dev Cell. 11, 251-62. Wharton, R. P., Sonoda, J., Lee, T., Patterson, M. und Murata, Y., 1998. The Pumilio RNAbinding domain is also a translational regulator. Mol Cell. 1, 863-72. Wharton, R. P. und Struhl, G., 1989. Structure of the Drosophila BicaudalD protein and its role in localizing the the posterior determinant nanos. Cell. 59, 881-92. Wharton, R. P. und Struhl, G., 1991. RNA regulatory elements mediate control of Drosophila body pattern by the posterior morphogen nanos. Cell. 67, 955-67. Wheeler, W. M., 1893. A Contribution to Insect Embryology. Journal of Morphology. 8, 160. White, E. K., Moore-Jarrett, T. und Ruley, H. E., 2001. PUM2, a novel murine puf protein, and its consensus RNA-binding site. RNA. 7, 1855-66. White, R. A. und Lehmann, R., 1986. A gap gene, hunchback, regulates the spatial expression of Ultrabithorax. Cell. 47, 311-21. Wickens, M., Bernstein, D. S., Kimble, J. und Parker, R., 2002. A PUF family portrait: 3'UTR regulation as a way of life. Trends Genet. 18, 150-7. Wilkinson, D. G., 1998. In situ hybridization a practical approach. Oxford University Press, Oxford. Wolff, C., Sommer, R., Schröder, R., Glaser, G. und Tautz, D., 1995. Conserved and divergent expression aspects of the Drosophila segmentation gene hunchback in the short germ band embryo of the flour beetle Tribolium. Development. 121, 4227-36. Woodhouse, E., Hersperger, E. und Shearn, A., 1998. Growth, metastasis, and invasiveness of Drosophila tumors caused by mutations in specific tumor suppressor genes. Dev Genes Evol. 207, 542-50. Wreden, C., Verrotti, A. C., Schisa, J. A., Lieberfarb, M. E. und Strickland, S., 1997. Nanos and pumilio establish embryonic polarity in Drosophila by promoting posterior deadenylation of hunchback mRNA. Development. 124, 3015-23. Wright, T. R., Bewley, G. C. und Sherald, A. F., 1976. The genetics of dopa decarboxylase in Drosophila melanogaster. II. Isolation and characterization of dopa-decarboxylasedeficient mutants and their relationship to the alpha-methyl-dopa-hypersensitive mutants. Genetics. 84, 287-310. Xu, E. Y., Chang, R., Salmon, N. A. und Reijo Pera, R. A., 2007. A gene trap mutation of a murine homolog of the Drosophila stem cell factor Pumilio results in smaller testes but does not affect litter size or fertility. Mol Reprod Dev. 74, 912-21. Yang, X., Zarinkamar, N., Bao, R. und <strong>Friedrich</strong>, M., 2009. Probing the Drosophila retinal determination gene network in Tribolium (I): The early retinal genes dachshund, eyes absent and sine oculis. Dev Biol. 333, 202-14. Ye, B., Petritsch, C., Clark, I. E., Gavis, E. R., Jan, L. Y. und Jan, Y. N., 2004. Nanos and Pumilio are essential for dendrite morphogenesis in Drosophila peripheral neurons. Curr Biol. 14, 314-21. Zaessinger, S., Busseau, I. und Simonelig, M., 2006. Oskar allows nanos mRNA translation in Drosophila embryos by preventing its deadenylation by Smaug/CCR4. Development. 133, 4573-83. Zamore, P. D., Williamson, J. R. und Lehmann, R., 1997. The Pumilio protein binds RNA through a conserved domain that defines a new class of RNA-binding proteins. RNA. 3, 1421-33. Zhang, B., Gallegos, M., Puoti, A., Durkin, E., Fields, S., Kimble, J. und Wickens, M. P., 1997. A conserved RNA-binding protein that regulates sexual fates in the C. elegans hermaphrodite germ line. Nature. 390, 477-84. 263
- Seite 1 und 2:
Die Funktion von Genen der posterio
- Seite 3:
Danke! Obwohl als letztes verfasst,
- Seite 6 und 7:
Inhaltsverzeichnis 2.4.1. Die Segme
- Seite 8 und 9:
Inhaltsverzeichnis 3.1.2. Die Auswe
- Seite 10 und 11:
Summary 2 Thus, I could show that a
- Seite 12 und 13:
Zusammenfassung praktischen Durchf
- Seite 14 und 15:
Abbildungsverzeichnis Abb. 24: Sche
- Seite 16 und 17:
Abkürzungen Abkürzungen 8 AS: Ami
- Seite 19 und 20:
Allgemeine Einleitung Allgemeine Ei
- Seite 21 und 22:
Allgemeine Einleitung Tiere, hervor
- Seite 23 und 24:
I. Kapitel: I. 1. Einleitung Die Fu
- Seite 25 und 26:
I. 1. Einleitung 3; Davis und Patel
- Seite 27 und 28:
I. 1. Einleitung 1.2. Drosophila me
- Seite 29 und 30:
I. 1. Einleitung Butler, 1988). Int
- Seite 31 und 32:
I. 1. Einleitung zur Phosphorylieru
- Seite 33 und 34:
I. 1. Einleitung Gene ist in Tribol
- Seite 35 und 36:
I. 1. Einleitung Die frühe Regulat
- Seite 37 und 38:
I. 1. Einleitung wahrscheinlich üb
- Seite 39 und 40:
I. 1. Einleitung wie in Vertebraten
- Seite 41 und 42:
I. 1. Einleitung und Wharton, 1999)
- Seite 43 und 44:
I. 1. Einleitung des nanos-Verlusts
- Seite 45 und 46:
I. 1. Einleitung Außerdem zeigen n
- Seite 47 und 48:
1.5. Ziele des ersten Kapitels der
- Seite 49 und 50:
2. Ergebnisse I. 2. Ergebnisse 2.1.
- Seite 51 und 52:
I. 2. Ergebnisse Abb. 6: Sequenzver
- Seite 53 und 54:
I. 2. Ergebnisse Domäne vermittelt
- Seite 55 und 56:
2.2.2. nanos-Expression ist nur in
- Seite 57 und 58:
I. 2. Ergebnisse 2.3. pRNAi für na
- Seite 59 und 60:
I. 2. Ergebnisse einerseits, dass d
- Seite 61 und 62:
I. 2. Ergebnisse des Kopfes. Außer
- Seite 63 und 64:
I. 2. Ergebnisse Doppel-RNAi in ver
- Seite 65 und 66:
I. 2. Ergebnisse 2.4. Frühembryona
- Seite 67 und 68:
I. 2. Ergebnisse nächst ist zu beo
- Seite 69 und 70:
I. 2. Ergebnisse 61
- Seite 71 und 72:
I. 2. Ergebnisse Domäne. Diese ble
- Seite 73 und 74:
I. 2. Ergebnisse 65
- Seite 75 und 76:
I. 2. Ergebnisse terminaler Zielgen
- Seite 77 und 78:
I. 2. Ergebnisse Tatsächlich fehle
- Seite 79 und 80:
I. 2. Ergebnisse Abb. 15: nos/pum-R
- Seite 81 und 82:
I. 2. Ergebnisse Expression auf die
- Seite 83 und 84:
I. 2. Ergebnisse 2.7. Die Beteiligu
- Seite 85 und 86:
2.7.1. Tribolium brain-tumor I. 2.
- Seite 87 und 88:
I. 2. Ergebnisse 2.7.3. brat-RNAi f
- Seite 89 und 90:
I. 2. Ergebnisse kulas somit interm
- Seite 91 und 92:
Abb. 19: brain-tumor-RNAi führt zu
- Seite 93 und 94:
I. 2. Ergebnisse Keimbahn in Verbin
- Seite 95 und 96:
I. 2. Ergebnisse 2.8.3. pumilio spi
- Seite 97 und 98:
I. 2. Ergebnisse Präpuppe, deren M
- Seite 99 und 100:
3. Diskussion I. 3. Diskussion 3.1.
- Seite 101 und 102:
I. 3. Diskussion mann, 1998; Asaoka
- Seite 103 und 104:
I. 3. Diskussion leider nicht gepr
- Seite 105 und 106:
I. 3. Diskussion Möglicherweise ve
- Seite 107 und 108:
I. 3. Diskussion Marques-Souza et a
- Seite 109 und 110:
I. 3. Diskussion der antennalen Seg
- Seite 111 und 112:
I. 3. Diskussion Effekt, der erst i
- Seite 113 und 114:
I. 3. Diskussion Netzwerk, das zur
- Seite 115 und 116:
I. 3. Diskussion gerufene Vernetzun
- Seite 117 und 118:
I. 3. Diskussion Natürlich gibt es
- Seite 119 und 120:
I. 3. Diskussion 3.4. Das Zusammens
- Seite 121 und 122:
I. 3. Diskussion sion als Substrat
- Seite 123 und 124:
I. 3. Diskussion ren gt-Domäne üb
- Seite 125 und 126:
I. 3. Diskussion Außerdem hat otd-
- Seite 127 und 128:
I. 3. Diskussion on eines von Fakto
- Seite 129 und 130:
I. 3. Diskussion jeweiligen ersten
- Seite 131 und 132:
4. Material und Methoden I. 4. Mate
- Seite 133 und 134:
4.2.1. in situ Hybridisierung I. 4.
- Seite 135 und 136:
I. 4. Material und Methoden ohne Bl
- Seite 137:
Tab. 6: Primer für dsRNA Matrize I
- Seite 140 und 141:
II. 1. Einleitung 132 In Anlehnung
- Seite 142 und 143:
II. 1. Einleitung Entwicklung. Dabe
- Seite 144 und 145:
II. 1. Einleitung 1.3. RNAi-Screens
- Seite 146 und 147:
II. 1. Einleitung Serie zu beobacht
- Seite 148 und 149:
II. 1. Einleitung 140 schen Fragest
- Seite 150 und 151:
II. 1. Einleitung Augen und im zent
- Seite 152 und 153:
II. 1. Einleitung 1.4.3. Die iBeetl
- Seite 154 und 155:
II. 1. Einleitung sophila wegen tec
- Seite 156 und 157:
II. 1. Einleitung 1.5. Ziele des zw
- Seite 158 und 159:
II. 2. Ergebnisse nale Musterbildun
- Seite 160 und 161:
II. 2. Ergebnisse 152 Im nächsten
- Seite 162 und 163:
II. 2. Ergebnisse bei 30°C inkubie
- Seite 164 und 165:
II. 2. Ergebnisse 1999a) 156 Auch d
- Seite 166 und 167:
II. 2. Ergebnisse lichst effektiv z
- Seite 168 und 169:
II. 2. Ergebnisse 160
- Seite 170 und 171:
II. 2. Ergebnisse 162
- Seite 172 und 173:
II. 2. Ergebnisse Abb. 29: Arbeitsp
- Seite 174 und 175:
II. 2. Ergebnisse Ergebnisse der Po
- Seite 176 und 177:
II. 2. Ergebnisse von RNAi-Effekten
- Seite 178 und 179:
II. 2. Ergebnisse 2.3. Es konnten f
- Seite 180 und 181:
II. 2. Ergebnisse Abb. 32: Zusammen
- Seite 182 und 183:
II. 2. Ergebnisse Abb. 33: Defekte
- Seite 184 und 185:
II. 2. Ergebnisse zu trennen. So k
- Seite 186 und 187:
II. 2. Ergebnisse 2.3.2. Defekte w
- Seite 188 und 189:
II. 2. Ergebnisse Abb. 35: Morpholo
- Seite 190 und 191:
II. 2. Ergebnisse diesen Phänotype
- Seite 192 und 193:
II. 2. Ergebnisse 184
- Seite 194 und 195:
II. 2. Ergebnisse Abb. 37: In adult
- Seite 196 und 197:
II. 2. Ergebnisse Abb. 38: Bisher u
- Seite 198 und 199:
II. 3. Diskussion des ersten Jahres
- Seite 200 und 201:
II. 3. Diskussion analysiert werden
- Seite 202 und 203:
II. 3. Diskussion Meinung, dass der
- Seite 204 und 205:
II. 3. Diskussion jeweils zu Beginn
- Seite 206 und 207:
II. 3. Diskussion nach den gleichen
- Seite 208 und 209:
II. 3. Diskussion in Tribolium, nic
- Seite 210 und 211:
II. 3. Diskussion 1980). Bei der Ka
- Seite 212 und 213:
II. 3. Diskussion phänotypische Hi
- Seite 214 und 215:
II. 3. Diskussion 3.2.6. iBeetle ha
- Seite 216 und 217:
II. 3. Diskussion Prozesse der Inse
- Seite 218 und 219:
II. 4. Material und Methoden Phenol
- Seite 220 und 221: II. 4. Material und Methoden pigmen
- Seite 222 und 223: II. 4. Material und Methoden 214 Em
- Seite 224 und 225: II. 4. Material und Methoden bei de
- Seite 226 und 227: II. 4. Material und Methoden 218 Ti
- Seite 229 und 230: Allgemeine Diskussion Allgemeine Di
- Seite 231: Allgemeine Diskussion und Achsendet
- Seite 234 und 235: Anhang ACCCATCCGTACGGCTGCCGGGTCATTC
- Seite 236 und 237: Anhang 2. Ergänzende Ergebnisse zu
- Seite 238 und 239: Anhang 3. Zeitaufwand der iBeetle-A
- Seite 240 und 241: Anhang 5. Zusammenfassung der Ergeb
- Seite 242 und 243: 234 134 900 14 similar to D123 (cdc
- Seite 244 und 245: 236 77 1500 57 gene without homolog
- Seite 246 und 247: 238 43 1000 99 similar to Rab-prote
- Seite 248 und 249: Anhang gemischt embryonal letal von
- Seite 250 und 251: Literatur Literatur Abdel-Latief, M
- Seite 252 und 253: Literatur Bernstein, D., Hook, B.,
- Seite 254 und 255: Literatur Ciglar, L. und Furlong, E
- Seite 256 und 257: Literatur Falciani, F., Hausdorf, B
- Seite 258 und 259: Literatur Gutjahr, T., Vanario-Alon
- Seite 260 und 261: Literatur Kiger, A. A., Baum, B., J
- Seite 262 und 263: Literatur Lin, H. und Spradling, A.
- Seite 264 und 265: Literatur binding protein that phys
- Seite 266 und 267: Literatur Riddiford, L. M., Hiruma,
- Seite 268 und 269: Literatur Schüpbach, T. und Wiesch
- Seite 272: Literatur Zhang, X. D. und Heyse, J