francine blumental de abreu - PHL © Elysio - FUNDAÇÃO ANTÔNIO ...

More documents

Recommendations

Info

grupo 2: SM37) que apresentaram a mesma deleção por aCGH, e de seis familiares, sendo dois da paciente SM56 (SM56.2 e SM56.3) e quatro da SM37 (SM37.2, SM37.3, SM37.4 e SM37.5). Tabela 8 - Iniciadores utilizados nas amplificações pela PCR. Gene Chr Seqüências ROBO1 GAPDH* Reação de Validação 3 (P1) (I4-5) 3 (P2) (E4) F: 5’ CCTCTGTCCTCAAATTCCCTTGGA 3’ R: 5’ TGCTCTTAATCCTCTTGTCTCACGA 3’ F: 5’ GCAGGCTCCCGTCTTCGTCA 3’ R: 5’ GCAGTTCAAAGTTGCAGGTTCTCCT 3’ Mapeamento da alteração 3 (P1) (E4) 3 (P2) (E4) 3 (P3) (E4) 3 (P4) (E4) 3 (P5) (E4) 3 (P6) (E4) 12 (I2-3) F: 5’ GGTGTAGTCAAGGCGGACAC 3’ R: 5’ TGACGAAGACGGGAGCCTGC 3’ F: 5’ GCTAGGCCAATGTTATGCAGTG 3’ R: 5’ GCAGTTCAAAGTTGCAGGTTCTCCT 3’ F: 5’ GTTGAACACCCTTCAGACCTG 3’ R: 5’ GGTGTGAGCGAGGGTCATCT 3’ F: 5’ CACCCACTATTGAATGGTACA 3’ R: 5’ CCGTCCATGTACTATACGTAAG 3’ F: 5’ AATGTTGCTGCCGAGTGGAT 3’ R: 5’ GCGCCCAGTTTACTTACTGGCTAC 3’ F: 5’ AAGGAGTCTATGTCTGTGTAGCAAGG 3’ R: 5’ GATCAAACAAATGACGCCACTCTG 3’ F: 5’ GCAACCGGGAAGGAAATGA 3’ R: 5’ CAGGAGCGCAGGGTTAGTCA 3’ Tamanho do Amplicon 140 pb 99 pb 179 pb 209 pb 145 pb 122 pb 160 pb 118 pb 88 pb HPRT* X F: 5’ GAACGTCTTGCTCGAGATGTGA 3’ 110 pb (E3) R: 5’ TCCAGCAGGTCAGCAAAGAAT 3’ Legenda: * Genes endógenos; E: éxon; I: íntron; F: iniciador forward; R: iniciador reverse; P: par d 43
Figura 2 - Representação gráfica dos iniciadores utilizados na qPCR para confirmação da perda de sequências do gene ROBO1. A. O ROBO1 apresenta 31 éxons. O retângulo em laranja representa a perda genômica identificada no íntron 4-5, detectada por aCGH, e o éxon mais próximo dessa alteração. B. Esquema das oito sondas mapeadas nessa região (S19 a S26). A região das sondas destacadas pelo retângulo foram selecionadas para validação no experimento de qPCR. As letras em vermelho representam as sequências dos iniciadores e em cinza, as sequências das sondas. P1_F e P1_R: par de iniciador 1 forward e reverse, respectivamente; P2_F e P2_R: par de inciador 2 forward e reverse, respectivamente; S: sonda. 44
Page 1 and 2:
VARIAÇÃO NO NÚMERO DE CÓPIAS GE
Page 3 and 4:
A minha família!!!! DEDICATÓRIA
Page 5 and 6:
À minha orientadora... Dra Silvia
Page 7 and 8:
As Instituições de Fomento... FAP
Page 9 and 10:
Entre os pacientes sem mutação, f
Page 11 and 12:
(exclusive from group 1) and FOXP1
Page 13 and 14:
Figura 11 Representação esquemát
Page 15 and 16: LISTA DE TABELAS Tabela 1 Classific
Page 17 and 18: Tabela 25 Alterações identificada
Page 19 and 20: LISTA DE SIGLAS E ABREVIATURAS aCGH
Page 21 and 22: UTR* Untranslated region VNTR* Vari
Page 23 and 24: 4.2.3 Análise de CNVs entre os fam
Page 25 and 26: O câncer colorretal (CCR) é o ter
Page 27 and 28: vezes, está associado com a histó
Page 29 and 30: análise de MSI é realizada pela P
Page 31 and 32: (2010) relataram que o tumor extrac
Page 33 and 34: 1.2 SÍNDROME DE CÂNCER DE MAMA-C
Page 35 and 36: PMS2). Segundo os autores, é mais
Page 37 and 38: contribuir para a patogênese e pro
Page 39 and 40: contém um elemento upstream que re
Page 41 and 42: 2 OBJETIVOS 2.1 OBJETIVO PRINCIPAL
Page 43 and 44: Figura 1 - Fluxograma representando
Page 45 and 46: o SMCMH2: pelo menos um indivíduo
Page 47 and 48: Tabela 1 - Dados clínicos e histop
Page 53 and 54: (1100delC) e TP53. Neste estudo, fo
Page 55 and 56: Tabela 5 - Iniciadores utilizados n
Page 57 and 58: Tabela 6 - Condições da PCR para
Page 59 and 60: As sequências alteradas foram clas
Page 61 and 62: por 2 horas e 65°C por 15 min. Foi
Page 63 and 64: As regiões identificadas como alte
Page 65: (http://www.ncbi.nlm.nih.gov, http:
Page 69 and 70: O gene de referência, GAPDH, é fr
Page 71 and 72: (tissue microarray - TMA), contendo
Page 73 and 74: citoplasmática moderada, porém em
Page 75 and 76: 4 RESULTADOS 4.1 SEQUENCIAMENTO 4.1
Page 77 and 78: Tabela 10 - Mutações não patogê
Page 79 and 80: Figura 5 - Representação gráfica
Page 81 and 82: número maior de CNVs, quando compa
Page 83 and 84: 21 não apresentaram CNVs. Por outr
Page 85 and 86: A. C. Figura 7 - Representação gr
Page 87 and 88: envolvida em perda genômica, prese
Page 89 and 90: Cont/ Tabela 11 Região Cromossômi
Page 101 and 102: As CNVs raras e novas raras foram c
Page 107 and 108: Cont/ Tabela 13 CNVs Raras Exclusiv
Page 115 and 116: Cont/ Tabela 14 CNVs Novas Raras Ex
Page 117 and 118:
Tabela 15 - Alterações com genes
Page 119 and 120:
Tabela 16 - Funções dos genes map
Page 121 and 122:
Entre as CNVs novas raras comuns ao
Page 123 and 124:
100
Page 125 and 126:
102 Entre as CNVs novas raras exclu
Page 127 and 128:
14q32.11: gene FOXN3 End: 89.136.41
Page 129 and 130:
7p22.2: gene MAD1L1 Start: 2.106.88
Page 131 and 132:
108 Entre as CNVs novas raras exclu
Page 133 and 134:
Start: 71.124.097 3p14.1: gene FOXP
Page 135 and 136:
Start: 71.478.161 17q25.1: genes AC
Page 137 and 138:
7q36.3: gene PTPRN2E2 Start: 158.00
Page 139 and 140:
Start: 49.039.910 13q14.3: gene RCB
Page 141 and 142:
mutações no gene de reparo MLH1 (
Page 143 and 144:
Tabela 18 - Alterações identifica
Page 145 and 146:
Cont/ Tabela 18 Casos SL36 (G2) Reg
Page 147 and 148:
124 Na Tabela 20 estão representad
Page 149 and 150:
família foi identificada apenas um
Page 151 and 152:
Page 153 and 154:
Page 155 and 156:
Page 157 and 158:
Cont/ Tabela 23 Casos Região Cromo
Page 159 and 160:
Page 161 and 162:
Page 163 and 164:
Figura 17 - Heredograma do caso SM5
Page 165 and 166:
142 A plataforma de 4x180K (Agilent
Page 167 and 168:
Start: 78.990.568 3p12.3: gene ROBO
Page 169 and 170:
146 Após a identificação, por CG
Page 171 and 172:
Figura 21 - Representação gráfic
Page 173 and 174:
Tabela 29 - Cálculo do intervalo d
Page 175 and 176:
Figura 23 - Análise gráfica dos r
Page 177 and 178:
epresenta uma comparação em barra
Page 179 and 180:
156 Após a caracterização da ext
Page 181 and 182:
ROBO1. Em 61,12% das amostras foi d
Page 183 and 184:
160 Tabela 33 - Associação entre
Page 185 and 186:
162 Não houve associação signifi
Page 187 and 188:
164 Tabela 34 - Associação entre
Page 189 and 190:
4.3.2 Família SM89 166 Após a con
Page 191 and 192:
168 No exame clínico, a probanda e
Page 193 and 194:
170 A SM89.2 (III:3), negativa para
Page 195 and 196:
172 A SM89.5 (IV:5), positiva para
Page 197 and 198:
174 A presença de pequenos cromoss
Page 199 and 200:
176 BRCA1 apresentaram 12 CNVs (SM8
Page 201 and 202:
Page 203 and 204:
Page 205 and 206:
5 DISCUSSÃO 182 As variações gen
Page 207 and 208:
câncer de mama e cólon. Grande pa
Page 209 and 210:
para mutação nos genes de predisp
Page 211 and 212:
N (SLC38A3 e SLC38A5), porém todos
Page 213 and 214:
alterações, GRM1, MAD1L1 e NPAS1
Page 215 and 216:
192 Neste estudo, o ganho genômico
Page 217 and 218:
sugeriram que a nova variante do ge
Page 219 and 220:
como linfomas, além de uma associa
Page 221 and 222:
taxas de crescimento celular quando
Page 223 and 224:
200 Segundo dados da literatura, os
Page 225 and 226:
de CNVs também foi observado nas p
Page 227 and 228:
5.1.3 Análise de CNVs entre os fam
Page 229 and 230:
colorretal, quatro em linhagem celu
Page 231 and 232:
produzidos durante o catabolismo do
Page 233 and 234:
envolvendo essa região cromossômi
Page 235 and 236:
tem sua eficiência 10 vezes reduzi
Page 237 and 238:
214 As GTPases são responsáveis p
Page 239 and 240:
carcinomas primários de cabeça e
Page 241 and 242:
com história familial avaliadas no
Page 243 and 244:
também demonstraram que pacientes
Page 245 and 246:
cromossômicas foram observadas tan
Page 247 and 248:
A paciente SM87 (grupo 2) apresento
Page 249 and 250:
226 Banyard J, Barrows C, Zetter BR
Page 251 and 252:
228 Chung GT, Sundaresan V, Hasleto
Page 253 and 254:
230 Fre S, Huyghe M, Mourikis P, Ro
Page 255 and 256:
232 Höglund PJ, Nordström KJ, Sch
Page 257 and 258:
234 Kuiper RP, Ligtenberg MJ, Hooge
Page 259 and 260:
236 Mills RE, Walter K, Stewart C,
Page 261 and 262:
238 Peltomäki P, Vasen HF. Mutatio
Page 263 and 264:
240 Selamat SA, Galler JS, Joshi AD
Page 265 and 266:
242 Thélu J, Rossio P, Favier B. N
Page 267 and 268:
244 Wang J, Luo MH, Zhang ZX, et al
Page 269:
Anexo 1 - Heredogramas
Page 324:
Anexo 3 - Critérios de Bethesda pa
show all

francine blumental de abreu - PHL © Elysio - FUNDAÇÃO ANTÔNIO ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?